| Plasmid name |
Record number |
Other names |
Vector |
Purpose and notes |
Antisense |
| a-tubulin |
269 |
alpha tubulin |
pCMV-SPORT6.1 |
BC061297
Xenopus tropicalis tubulin, alpha 1, mRNA (cDNA clone MGC:75767 IMAGE:5381815), complete cds
gi|38511929|gb|BC061297.1|[38511929]
internal RI/notI site
|
|
| a1-ATPasea |
250 |
a1-ATPase alpha1-ATPase Na/K ATPase a1 subunit endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19434432
EST name: AGENCOURT_15040604
GenBank Acc: CF220660
GenBank gi: 33421368
CLONE INFO
Clone Id: IMAGE:6988026 (5') |
KpnI/T7* |
| Activin beta b subunit |
196 |
activin |
CS107 |
Tneu142F12 |
|
| ADMP1 |
304 |
ADMP CS107 |
CS107 |
prepped version of clone Tgas066c03
sequenced 6/24/05
Do NOT use:
Ecor1
bamH1
hindIII
XbaI
|
T7 Cla1 |
| ADMP1/pcmv |
305 |
|
pCMV Sport 6.1 |
sequence confirmed 6/24/05
prep of Image clone 6990706, intended for subcloning into CS108 for probe/mRNA
can also use record #304 for same purpose
|
|
| ADMP2 |
290 |
ADMP2 CS107 |
CS107 |
this is a prep from ordered clone number Tneu087d02.
sequence verified
in situ pattern is faint; anterior neural.
|
T7/BamH1 |
| alpha tubulin |
181 |
tubulin a-tubulin alpha tubulin |
pCMV-sport6.1 |
>gi|33245881|gb|CF149613.1|CF149613 AGENCOURT_14929401 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone
IMAGE:6980422 5'.
We thought this was gridlock but seq. confirms that it is tubulin |
kpnI/T7 |
| ap2 |
210 |
ap2 ap-2 |
CS107 |
Tgas030K20 |
claI/T7 |
| Axial protocadherin |
137 |
apc axial protocadherin |
CS107 |
Tegg092J24
3' end not all there |
EcoRI/T7* |
| Axial protocadherin |
139 |
apc axial protocadherin |
CS107 |
Tegg017F14 |
EcoRI/T7 |
| Axin related |
199 |
axin related |
CS107 |
Tneu129J09
The first few nucleotides may be missing in this clone - just short of full length |
|
| BAMBI |
195 |
bambi |
CS107 |
Tegg028M12 |
T7/ClaI* |
| BAMBI |
198 |
|
CS107 |
TEgg127M13 |
T7/ClaI |
| beta-catenin |
236 |
beta-catenin b-catenin catenin |
CS107 |
|
|
| BMP2 |
202 |
bmp2 bmp-2 bone morphogenetic protein 2 |
CS107 |
Tegg105I19 |
T7/ClaI* |
| BMP2 |
207 |
bmp2 bmp-2 |
CS107 |
Tgas025A06 |
|
| BMP4 |
193 |
bmp-4 bmp4 bone morphogenetic protein4 |
CS107 |
Tneu045C17
This clone has a very short insert. |
T7/ClaI |
| BMP4 |
194 |
bmp-4 bmp4 bone morphogenetic protein4 |
CS107 |
Tneu059F22
This clone also has a very short insert |
T7/ClaI |
| BMP4 |
212 |
bmp 4 bmp-4 bmp4 bone morphogenetic protein |
CS107 |
Tneu015d14 |
claI/t7 |
| bmp4 |
231 |
bmp4 bmp-4 bone morphogenetic protein |
CS107 |
Tgas125E13 |
claI/T7 |
| BMP7 |
61 |
BMP BMP-7 BMP7 bmp7 bmp-7 bmp-7R |
CS107 |
Genbank ID#BG514944
bamH1 (t7) ok as well - NOT hind III
*this clone has been tested and works for in situ
This clone encodes a protein more similar to "BMP-7R" of X. laevis than to "BMP-7," see Wang et al. 1997, Genes and Function for comparison of proteins.
see also clone 306 "BMP7-new" |
RI/T7* |
| BMP7 new |
306 |
BMP7 pCMV, |
pCMV sport 6.1 |
prepped version of IMAGE 5384686.
this is a better match to the "real" BMP7 (see Wang, Moos 1997, Genes and Function) than our clone #61 BMP7 (BMP7R).
This has been CS110K, record #310, but 306 also makes a fine probe
sequence confirmed 6/24/05
do NOT use Ecor1 |
T7/kpn1 |
| BMP7-CS110K |
310 |
BMP7 |
CS110K |
this is the "real" BMP7 of record 306 subcloned into Maura's 110K vector.
Kanamycin selection!!
do not use not1
do not use
(some restriction sites are inverted vs. record 306 following recombination reaction) |
T7 |
| C3 |
246 |
Complement C3 edoderm |
pCMV-SPORT6.1 |
dbEST Id: 19453773
EST name: AGENCOURT_15100521
GenBank Acc: CF239870
GenBank gi: 33443078
CLONE INFO
Clone Id: IMAGE:6994794 (5') |
|
| Cart-1 |
291 |
cart1 cart-1 cartilage |
pCMVsport6 |
LOCUS CX939893 849 bp mRNA linear EST 07-FEB-2005
DEFINITION JGI_CAAO6836.fwd NIH_XGC_tropTe5 Xenopus tropicalis cDNA clone
IMAGE:7703480 5', mRNA sequence.
ACCESSION CX939893
VERSION CX939893.1 GI:58729651
Site_1: SalI; Site_2: NotI; |
KpnI/T7 |
| Cerberus |
21 |
Cerberus cerberus |
CS107 |
LIG10F05
AL638969 |
T7/BamH1 *(not Ecor1) |
| Cerberus |
36 |
cerberus Cerberus CERBERUS |
CS107 |
Tgas016C17 |
T7 BamH1 (not Ecor1) |
| Ches1 |
163 |
fkhd forkhead fox ches1 FoxN3 |
CS107 |
Tgas027E12 |
|
| Chito |
242 |
Chito endoderm Glycosyl hydrolases / di-N-acetylchitobiase |
pExpress-1 |
dbEST Id: 19634136
EST name: AGENCOURT_15324914
GenBank Acc: CF375459
GenBank gi: 34312903
CLONE INFO
Clone Id: IMAGE:7007227 (5')
For vector information see
http://zgc.nci.nih.gov/Vectors/vec_pexpress-1
For probe XmaI,EcoRI, RsrII T7 |
|
| Chordin |
1 |
Chordin chordin |
CS107 |
Tgas122K5 |
|
| Chordin |
3 |
Chordin chordin |
CS107 |
Tgas133K5 |
T7 Ecor1 |
| Chordin |
4 |
Chordin chordin |
CS107 |
Tgas083F21 |
T7 Ecor1 |
| Chordin |
6 |
Chordin chordin |
CS107 |
Tneu011C22 |
T7 Ecor1* |
| Chordin |
7 |
Chordin chordin |
CS107 |
Tneu140P12 |
T7 Ecor1 |
| Chordin |
13 |
Chordin chordin |
CS107 |
Tneu029D7 |
T7 not R1 - use Bamh1 |
| Chordin |
14 |
Chordin chordin |
CS107 |
Tneu033C4 |
T7 Ecor1 |
| Chordin |
16 |
Chordin chordin |
CS107 |
Tneu005F12 |
T7 Ecor1 |
| Chordin |
19 |
Chordin chordin |
CS107 |
Tneu080L20 |
T7 Ecor1 |
| Churchill |
222 |
churchill |
CS107 |
TTpA047h20 |
BamHI/T7* |
| Collagen A Type II |
288 |
Collagen II A |
pCMV-SPORT6.1 |
ACCESSION BC063191
full length sequence available |
AgeI/T7 |
| Coronin |
55 |
coronin |
CS107 |
Genbank ID# BG512194
dad26g11.y1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4440788 5' similar to TR:Q9PWG8 Q9PWG8 CORONIN HOMOLOG. ;, MRNA sequence |
|
| cpl1 |
235 |
cpl1 cpl-1 lipocalin |
CS107 |
Cloned into assymetric SfI I sites. 5' EcorI NotI 3'
for probes linearize with EcoRI or Kpn I |
T7/KpnI |
| Crescent |
150 |
crescent frzb2 frzb-2 |
CS107 |
Tneu117G19 |
claI/T7 |
| Crescent |
151 |
crescent frzb2 frzb-2 |
CS107 |
Tneu018n22
3' end appears to be chimeric with translation initiation factor |
|
| Crescent |
152 |
crescent frzb2 frzb-2 |
CS107 |
Tneu142G13 |
|
| cytokeratin |
270 |
cytokeratin epidermal keratin |
pCMV-SPORT6.1 |
EST name: AGENCOURT_15113715
GenBank Acc: CF240450
GenBank gi: 33443658
CLONE INFO
Clone Id: IMAGE:6991625 (3') |
EcoRI/T7 |
| cytokeratin |
271 |
cytokeratin epidermal keratin |
pCMV-SPORT6.1 |
dbEST Id: 19309082
EST name: AGENCOURT_14905694
GenBank Acc: CF152092
GenBank gi: 33248600
CLONE INFO
Clone Id: IMAGE:6984581 (5') |
|
| Dazap2 |
96 |
Dazap-2 dazap2 proline-rich protein, 81E10 |
CS107 |
|
ClaI/T7 |
| delta |
281 |
delta |
sport6 |
Image clone 6988912 |
t7/kpn1 |
| derriere |
69 |
derriere |
CS107 |
Tgas141F11
*tested for in situ - works |
RI/T7* |
| DG42 |
247 |
Hyaluronan synthase 1 DG42 endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19434270
EST name: AGENCOURT_15041124
GenBank Acc: CF220501
GenBank gi: 33421209
CLONE INFO
Clone Id: IMAGE:6988222 (5') |
|
| dHAND |
277 |
dHAND |
pCMV-SPORT6.1 |
EST name: AGENCOURT_14980561
GenBank Acc: CF218564
GenBank gi: 33419272
CLONE INFO
Clone Id: IMAGE:6989521 (5') |
|
| Dickkopf-1 |
2 |
Dickkopf-1 dickkopf1 dkk |
CS107 |
Tgas131C10 |
T7/R1*
BamH1 and HindIII ok too |
| DLL2 |
120 |
xdll2 dll DLL |
CS107 |
Likely have 3'
Don't have 5'
TGAS040e17 |
|
| dll2 |
125 |
dll-2 DLL xdll2 |
CS107 |
no 5'
3' - not sure
TNeu022006 |
claI/T7 |
| DLL3 |
116 |
dll3 dll |
CS107 |
don't have 5'
TNeu139d17 |
claI/T7 |
| dlx2 |
307 |
dlx-2 |
pCMV-SPORT6.1 |
LOCUS NM_001008060 2508 bp DEFINITION Xenopus tropicalis dlx2-prov protein (dlx2-prov), mRNA.
ERSION NM_001008060.1 GI:56118495
LOCUS BC080947 2508 bp mRNA linear VRT 08-MAR-2005
DEFINITION Xenopus tropicalis dlx2-prov protein, mRNA (cDNA clone MGC:79639
IMAGE:6980076), complete cds.
ACCESSION BC080947 GI:51704086
Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV; |
|
| EF1alpha |
103 |
|
CS108 |
|
|
| Emx1 |
251 |
emx1 empty spiracles 1 forebrain |
pCMV-SPORT6.1 |
LOCUS BC074580 1377 bp mRNA linear VRT 25-JUN-2004
DEFINITION Xenopus tropicalis cDNA clone MGC:69381 IMAGE:5335247, complete
cds.
EST name: NISC_nl02b12.y1
GenBank Acc: BQ520008
GenBank gi: 21378877
CLONE INFO
Clone Id: IMAGE:5335247 (5' |
Kpn1/T7* |
| emx1 |
254 |
emx-1 emx1 |
CS107 |
TNeu052k18
gi|38337578|gb|BX688458.1|BX688458 BX688458 XGC-neurula
Xenopus tropicalis cDNA clone TNeu052k18 3', mRNA sequence |
|
| emx2 |
255 |
emx-2 emx2 |
CS107 |
I am not sure which one.
gi|48676054|gb|CR407807.1|CR407807 CR407807 XGC-tailbud
Xenopus tropicalis cDNA clone TTbA001k13 5', mRNA sequence
Query= gi|38311649|gb|AL789146.2|AL789146 AL789146 XGC-neurula
Xenopus tropicalis cDNA clone TNeu125h20 5', mRNA sequence |
claI/T7 |
| emx3 |
188 |
emx3 |
pCMV-sport6.1 |
uncertain if emx1 or emx2
AGENCOURT_15065581 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:6978117 3', MRNA sequence
gi|33425498|gb|CF224790.1|[33425498]
AGENCOURT_15066333 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:6978117 5', MRNA sequence
gi|33425497|gb|CF224789.1|[33425497]
|
Asp718/T7* |
| En-1 |
318 |
engrailed1 engrailed-1 en1 en-1 |
PCR2.1 topo |
~1000 bp PCR fragment was amplified and cloned using the TOPO TA kit into |
HindIII/T7 |
| En-2 |
154 |
engrailed-2 en2 |
pCRII-TOPO 3950 nt |
an en-2 probe was amplified using the primers TGGGGAAGGAGATGCTTTGC
and TGGGCTGCTGAGAGGTTTTG.
pCRII-Topo also has a kanR cassette.
|
speI/T7* |
| Endocut |
244 |
endocut Glutamate carboxypeptidase M20 endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19435911
EST name: AGENCOURT_14995193
GenBank Acc: CF222137
GenBank gi: 33422845
CLONE INFO
Clone Id: IMAGE:6986243 (5') |
|
| Endodermin |
100 |
edd endodermin |
pCMV-SPORT6.ccdb |
dbEST Id: 12638199
EST name: NISC_no19b07.y1
GenBank Acc: BQ526904
GenBank gi: 21385773
CLONE INFO
Clone Id: IMAGE:5381340 (5')
Source: IMAGE Consortium, LLNL
|
|
| Endodermin |
109 |
endodermin, edd |
CS107 |
dbEST Id: 12638199
EST name: NISC_no19b07.y1
GenBank Acc: BQ526904
GenBank gi: 21385773
CLONE INFO
Clone Id: IMAGE:5381340 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11971 Row: D Column: 13
|
|
| Endodermin |
219 |
endodermin |
pCMV-SPORT6.1 |
EST name: AGENCOURT_14928500
GenBank Acc: CF149137
GenBank gi: 33245405
CLONE INFO
Clone Id: IMAGE:6978356 (5')
antisense try RI or kpnI T7 |
|
| Endothelin-1 |
287 |
entdothelin-1 endothelin1 |
CS107 |
TTpa039J07 |
|
| Eomesodermin |
204 |
eomesodermin |
CS107 |
Tgas141F06 |
RI/T7* |
| Eomesodermin |
205 |
eomesodermin |
CS107 |
Tgas015D23
3' end gives no hits |
|
| Eph receptor tyrosine kinase |
186 |
eph |
CS107 |
TGas045P01 |
ClaI/T7 |
| EphB4 |
184 |
vascular ephb4 |
CS107 |
Tgas046K17 |
claI/T7* |
| EphB4 |
185 |
vascular ephb4 |
CS107 |
TNeu111K19 |
ClaI/T7 |
| Ephrin b2 |
237 |
ephrin b2 |
pCMV-SPORT6.1 |
dbEST Id: 12435154
EST name: NISC_mq12f01.y1
GenBank Acc: BQ390329
GenBank gi: 21078016
CLONE INFO
Clone Id: IMAGE:5308177 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11780 Row: L Column: 2 |
|
| EphrinB2 |
179 |
ephrin ephrinB2 ephrin-B2 |
pCMV-sport6.1 |
NISC_mq03c02.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5307266 5', MRNA sequence
gi|21076361|gb|BQ388674.1|[21076361]
NISC_mq03c02.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5307266 3', MRNA sequence
gi|21076360|gb|BQ388673.1|[21076360]
|
Asp718/T7 |
| Epidermal Keratin |
101 |
epidermal keratin keratin epidermis |
CS108 |
insert cloned into sal I-Not I |
|
| esr4 |
70 |
ESR4 esr |
CS107 |
Likely have 3'
Don't have 5'
TNeu125H16 |
|
| ESR4 |
119 |
esr4 Esr4 |
CS107 |
5' not present
TNEU138e11 |
|
| Fast1 |
164 |
fkhd forkhead fox Fast1 FoxH3 |
CS107 |
Tegg015N21 |
|
| Fetuinish |
249 |
Fetuinish Cystatin protease inhibitor / Fetuin-b endoderm |
pExpress-1 |
dbEST Id: 19889197
EST name: AGENCOURT_15703449
GenBank Acc: CF593173
GenBank gi: 36346442
CLONE INFO
Clone Id: IMAGE:7025331 (5') |
|
| FGF-8 |
220 |
fgf-8 fgf8 fibroblast growth factor 8 fgf |
pCMV-SPORT6.1 |
dbEST Id: 19308323
EST name: AGENCOURT_14904188
GenBank Acc: CF151333
GenBank gi: 33247841
CLONE INFO
Clone Id: IMAGE:6983047 (5')
antisense try RI or kpnI T7 |
|
| FGF8 |
90 |
FGF8 fibroblast growth factor fgf-8 |
CS107 |
Tneu007i10 |
|
| FGF8 |
95 |
fgf-8 fgf8 fibroblast growth factor |
CS107 |
TNeu007I10
*Been tested and works on in situ |
T7/R1* |
| FGFR1 |
80 |
FGFR1 fibroblast growth factor receptor FGFR-1 |
CS107 |
Tneu049H18 |
|
| FGFR2 |
77 |
FGFR2 FGFR fibroblast growth factor receptor FGFR-2 |
CS107 |
Tgas066A10 |
|
| fgfr2 |
115 |
fibroblast growth factor receptor-2 fgfr |
CS107 |
AL637435
Don't have 5'
Clone Lig8c12 |
|
| fgfr2 |
122 |
fgfr2 fibroblast growth factor receptor 2 fgfr-2 |
CS107 |
No 5'
TGas066a10 |
|
| FGFR4a |
87 |
FGFR4a fibroblast growth factor receptor FGFR-4a |
CS107 |
Tgas028m19 |
|
| Fibronectin |
64 |
fibronectin |
CS107 |
Genbank accession #BG886270 |
|
| Fkh5 |
73 |
Fkh5 foxb1 forkhead5 forkhead-5 fkh-5 |
CS107 |
Tgas064p06 |
|
| Fkh5 |
84 |
Fkh5 forkhead5 forkhead-5 fkh-5 |
CS107 |
Tgas053m03 |
|
| Fkh6 |
83 |
fkh6 foxD3 forkhead6 forkhead-6 fkh-6 XFD6 |
CS107 |
Tgas035o17 |
|
| Fli |
302 |
fli vascular |
pCS108 |
DEFINITION JGI_XZT46477.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7621709 5', mRNA sequence.
ACCESSION CX342033
VERSION CX342033.1 GI:57078505
Site_1: SalI; Site_2: NotI |
|
| flk-1 |
294 |
flk1 vasciular flk-1 |
pCS108 |
DEFINITION JGI_XZT45538.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7620420 5', mRNA sequence.
ACCESSION CX341075
VERSION CX341075.1 GI:57077547
Site_1: SalI; Site_2: NotI; |
|
| follistatin |
68 |
follistatin |
CS107 |
dad17g05.y1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4439985 5' similar to TR:Q91376 Q91376 FOLLISTATIN. ;.
BG348597 |
T7 Bamh1*(not R1) |
| forkhead |
157 |
fkhd forkhead fox |
CS107 |
Tgas019F24
This clone has weak similarity to XFD2 (FoxI1a) |
|
| forkhead |
175 |
fkhd forkhead fox
|
CS107 |
Tgas019F21
weak similarity to XFD2 |
|
| Forkhead box I1 |
176 |
fkhd forkhead foxI1 |
pCMV-sport6.1 |
NISC_ng06a02.y1 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:5382411 5', MRNA sequence
gi|21081568|gb|BQ393881.1|[21081568]
|
|
| Foxa2 |
136 |
fox foxa2 hnf3b hnf3beta hnf |
CS107 |
Tneu069I04 |
ClaI/T7* |
| FoxD3 |
216 |
foxd3 |
CS107 |
dbEST Id: 19434281
EST name: AGENCOURT_15040932
GenBank Acc: CF220512
GenBank gi: 33421220
CLONE INFO
Clone Id: IMAGE:6988210 (5' |
SalI/T7 |
| FoxI1 |
166 |
fkhd forkhead foxi1 XFD2 |
CS107 |
Tegg136P02 |
|
| FoxI1 |
171 |
fkhd forkhead foxI1 XFD2 |
CS107 |
Tneu084P05 |
|
| FoxI1a |
23 |
xFD2 fox FoxI1a |
CS107 |
Tneu012H23 |
T7 Ecor1 |
| FoxI1a |
32 |
xFD2 fox FoxI1a |
CS107 |
Tgas002H16
Maybe have 5' of gene also
*this clone has been tested and works for in situ |
T7 BamHI* |
| FoxI1c |
162 |
FoxI1c fkhd forkhead fox XFD10 |
CS107 |
Tgas113F01 |
|
| Foxi3 |
161 |
FoxI3 fkhd forkhead fox |
CS107 |
Tegg138H22
most similar to foxi3 |
|
| Foxi3 |
169 |
fkhd forkhead foxi3 |
CS107 |
Tegg020K15 |
|
| FoxJ1 |
173 |
fkhd forkhead foxJ1 |
pCMV-sport6.1 |
NISC_mq24c11.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 5', MRNA sequence
gi|21080102|gb|BQ392415.1|[21080102]
NISC_mq24c11.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 3', MRNA sequence
gi|21080101|gb|BQ392414.1|[21080101]
|
|
| FoxJ1 |
191 |
fkhd foxj1 |
pCMV-SPORT6.1 |
NISC_mq24c11.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 5', MRNA sequence
gi|21080102|gb|BQ392415.1|[21080102]
NISC_mq24c11.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 3', MRNA sequence
gi|21080101|gb|BQ392414.1|[21080101]
|
|
| FoxJ2 |
174 |
fkhd forkhead fox J2 |
pCMV-sport6.1 |
NISC_nl03a03.y1 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:5335204 5', MRNA sequence
gi|21378989|gb|BQ520120.1|[21378989]
|
|
| FoxN4 |
172 |
fkhd forkhead foxN4 |
CS107 |
Tegg019G15 |
|
| Foxq1 |
167 |
fkhd forkhead foxq1 |
CS107 |
Tneu015L12 |
|
| Frzb |
65 |
Frzb |
CS107 |
Genbank Accession #BG886039
not BamH1 - HindIII or R1 OK |
RI/T7* |
| Frzb |
72 |
Frzb fzb |
CS107 |
Tgas069i22 |
|
| Frzb |
74 |
Fzb frzb |
CS107 |
Tneu037b10 |
|
| Fugacin |
53 |
fugacin xnr3 xnr nodal related 3 |
CS107 |
see Genbank ID# BG886280
dad51c07.x1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4462861 3' similar to TR:Q91621 Q91621 FUGACIN. ;, MRNA sequence
gi|14263370|gb|BG886280.1|[14263370] |
T7 Cla1 |
| Gata-4 |
258 |
gata4 gata-4 |
CS107 |
TGas120j19
gi|38703057|gb|AL960651.2|AL960651 AL960651 XGC-gastrula
Xenopus tropicalis cDNA clone TGas120j19 5
|
|
| Gata-4 |
259 |
gata4 gata-4 |
CS107 |
TGas112g01
gi|39015137|gb|AL963806.2|AL963806 AL963806 XGC-gastrula
Xenopus tropicalis cDNA clone TGas112g01 5', mRNA sequence |
|
| gata-5 |
245 |
gata5 gata-5 endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19434277
EST name: AGENCOURT_15040996
GenBank Acc: CF220508
GenBank gi: 33421216
CLONE INFO
Clone Id: IMAGE:6988214 (5') |
|
| Gata-6 |
67 |
gata gata6 gata- 6 |
CS107 |
Genbank #BG885303 |
|
| Gata4 |
108 |
gata gata4 gata-4 |
CS107 |
TNeu111a24 |
BamHI/T7 |
| Gata6 |
110 |
gata gata-6 |
pCMV-sport6.1 |
dbEST Id: 12441064
EST name: NISC_ng19g04.y1
GenBank Acc: BQ396239
GenBank gi: 21083926
CLONE INFO
Clone Id: IMAGE:5383878 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11977 Row: N Column: 7 |
KpnI/T7 |
| gata6 |
111 |
gata gata-6 |
pCMV-SPORT6.1 |
dbEST Id: 12440736
EST name: NISC_ng17h04.y1
GenBank Acc: BQ395911
GenBank gi: 21083598
CLONE INFO
Clone Id: IMAGE:5383902 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11977 Row: O Column: 7
|
|
| Gata6 |
257 |
gata-6 gata6 |
pCMV-SPORT6.1 |
dbEST Id: 12441064
EST name: NISC_ng19g04.y1
GenBank Acc: BQ396239
GenBank gi: 21083926
CLONE INFO
Clone Id: IMAGE:5383878 (5') |
claI/T7 |
| Gata6 |
264 |
gata-6 gata6 |
pCMV-SPORT6.1 |
dbEST Id: 12440736
EST name: NISC_ng17h04.y1
GenBank Acc: BQ395911
GenBank gi: 21083598
CLONE INFO
Clone Id: IMAGE:5383902 (5') |
|
| Gbx 2 |
89 |
Gbx 2 gbx-2 gbx2 |
CS107 |
Tneu059g14 |
|
| Gbx2 |
82 |
Gbx-2 Gbx2 |
CS107 |
Tgas027p15 |
|
| gbx2 |
121 |
gbx2b gbx |
CS107 |
No 5'
Likely have 3'
TGas037A13
Probe Made* |
*ClaI/T7 |
| GDF6 CS107 |
289 |
GDF6 |
CS107 |
this is just a prepped version of clone Tgas137g21 from Russell's library.
sequence verified
In situ pattern matches published pattern for laevis (Chang and Hemmati-Brivanlou 1999), probe takes a couple days at 4 degrees to come up. |
T7/BamHI |
| geminin |
308 |
geminin |
pCMV-SPORT6.1 |
LOCUS CF218367 785 bp mRNA linear EST 04-AUG-2003
DEFINITION AGENCOURT_14976421 NICHD_XGC_Emb5 Xenopus tropicalis cDNA clone
IMAGE:6990029 5', mRNA sequence.
ACCESSION CF218367
VERSION CF218367.1 GI:33419075
/note="Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV; |
|
| Goosecoid |
38 |
goosecoid gsc |
CS107 |
Tgas02869
Likely have 5' also |
|
| Goosecoid |
39 |
goosecoid gsc |
CS107 |
Tgas129E16
Likely have 5' also
*Works for in situ (have probe) |
BamHi/T7* |
| Goosecoid |
40 |
goosecoid gsc |
CS107 |
Tgas028B9
Most likely have 5' end |
|
| Goosecoid |
42 |
goosecoid gsc |
CS107 |
Tgas091013 |
|
| Goosecoid |
43 |
Goosecoid gsc |
CS107 |
Tgas075013 |
|
| Goosecoid |
46 |
Goosecoid gsc |
CS107 |
Tneu077F20 |
|
| Gridlock |
213 |
gridlock hairy enhancer of split |
pCMV-SPORT6.1 |
dbEST Id: 19306363
EST name: AGENCOURT_14929401
GenBank Acc: CF149613
GenBank gi: 33245881
CLONE INFO
Clone Id: IMAGE:6980422 (5')
|
RI/T7 |
| hairy2b.sport |
280 |
hairy2 |
sport6 |
|
t7kpn1 |
| Hb9 |
218 |
hb9 xhb9 motor neuron marker |
pCMV-SPORT6.1 |
dbEST Id: 12438700
EST name: NISC_ng05h11.y1
GenBank Acc: BQ393875
GenBank gi: 21081562
CLONE INFO
Clone Id: IMAGE:5382764 (5')
Source: IMAGE Consortium, LLN
antisense try RI or kpnI T7 |
kpnI/T7 |
| Hesr-1 |
144 |
hes related 1 hes hesr hesr1 hesr-1 |
CS107 |
Tegg121I16 |
claI/T7 |
| Hnf3a |
112 |
hnf3alpha hnf3a hnf FoxA1 |
CS107 |
TGas068H09 |
RI/T7* |
| hox1a |
126 |
HOX1A hox |
CS107 |
Tneu090p03
it may be hoxb4 but blasted similarity to hox1a |
claI/T7 |
| HoxB9 |
187 |
hoxb9 |
pCMV-Sport6.1 |
AGENCOURT_15100128 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:6996089 5', MRNA sequence
gi|33441773|gb|CF238565.1|[33441773]
|
EcoRI/T7* |
| HoxB9 |
221 |
hoxb9 |
pCMV-SPORT6.1 |
EST name: NISC_ng04d10.y1
GenBank Acc: BQ393597
GenBank gi: 21081284
CLONE INFO
Clone Id: IMAGE:5382211 (5'
LOCUS BC059757 1356 bp mRNA linear VRT 03-FEB-2004
DEFINITION Xenopus tropicalis hypothetical protein MGC75797, mRNA (cDNA clone
MGC:75797 IMAGE:5382211), complete cds.
|
|
| HoxD10 |
11 |
HoxD10 hoxd10 |
CS107 |
Tneu001K5
Been tested for in situ - on trop website |
T7 Ecor1 |
| HoxD10 |
20 |
HoxD10 hoxd10 |
CS107 |
Tneu009D23 |
T7 Ecor1 |
| ID2 |
97 |
id-2 id2 id |
CS107 |
|
T7 |
| Id2 |
102 |
id id2 |
CS108 |
|
|
| ID3 |
54 |
id3 ID3 |
CS107 |
Also in Harland database - number 1789
CS107-4.1 kb
*this clone has been tested and works for in situ |
RI/T7* |
| Ikb |
315 |
ikappab, NF-kappaB inhibitor, ikb |
CS107 |
LOCUS CR760347 1535 bp mRNA linear VRT 15-SEP-2004
DEFINITION Xenopus tropicalis finished cDNA, clone TNeu099d12.
pCS107; Site_1: EcoRI; Site_2: NotI
|
EcoRI/T7 or BamHI/T7 should work |
| Imp2 |
243 |
Imp2 Inosine-50 -monophosphate dehydrogenase endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19435923
EST name: AGENCOURT_15039937
GenBank Acc: CF222149
GenBank gi: 33422857
CLONE INFO
Clone Id: IMAGE:6986234 (5') |
|
| Inturned |
71 |
Inturned |
CS107 |
TGas012e01
Genbank Accession # AL629224 |
claI/T7 |
| irx3 |
106 |
irx xiro3 xiro |
pCMV-SPORT6.1 |
Image 5383093 |
|
| IRX3 |
123 |
irx3, IRX, xiro3, xiro |
pCMV-SPORT6.1 |
Clone Image 5335930
*Works for in situ |
R1/T7* |
| Islet-1 |
142 |
islet islet1 islet-1 |
CS107 |
Tneu086d13 |
claI/T7 |
| kit ligand |
253 |
kit steel-2 steel2 stem cell factor scf |
pExpress-1 |
dbEST Id: 19886644
EST name: AGENCOURT_15681669
GenBank Acc: CF590621
GenBank gi: 36341257
CLONE INFO
Clone Id: IMAGE:7022366 (5') |
claI/T7 |
| Krox-20 |
155 |
krox20 krox-20 |
pCRII-TOPO 3950 nt |
a portion of Krox20 was amplified from cDNA using the primers GCCCCCATAACTTACCACTTCG and GGATTTTTGTGTGCCTTTTGCG.
pCRII-Topo also has a kanR cassette. |
SpeI/T7* |
| Lbx1 |
268 |
lbx1 |
CS107 |
Ttpa050H02 |
|
| Lefty |
183 |
lefty antivin |
CS107 |
Tgas031A08 |
|
| Lefty |
189 |
lefty antivin |
CS107 |
Tgas024D09
May have 18s ribosomal RNA somewhere in there? Try Clone #183
|
|
| Lefty |
192 |
lefty antivin |
CS107 |
Tgas052N03 |
|
| MEIS3 |
25 |
MEIS3 Meis3 meis3 |
CS107 |
Clone L1G9F05
AL637544
*this clone has been tested and works for in situ |
T7/BamH1* |
| Meis3 |
26 |
Meis3 Meis meis3 meis |
CS107 |
Tgas014K23 |
T7 Ecor1 |
| Meis3 |
27 |
Meis3 Meis meis3 meis |
CS107 |
Tneu006021 |
T7 BamH1 (not Ecor1) |
| Mixer |
313 |
mixer |
CS107 |
LOCUS AL965856 294 bp mRNA linear EST 05-DEC-2003
DEFINITION AL965856 XGC-gastrula Xenopus tropicalis cDNA clone TGas105b05 5',
mRNA sequence.
pCS107; Site_1: EcoRI; Site_2: NotI |
claI/T7 |
| msr |
177 |
xangio1 msr vascular msr1 |
CS107 |
Tneu054M15 |
RI/T7* |
| Msx1 |
200 |
msx1 msx-1 xhox7.1 |
CS107 |
Tneu045P11 |
RI/T7 |
| Msx1 |
206 |
msx1 msx-1 xhox7.1 |
CS107 |
Tgas131G15 |
|
| msx2 |
190 |
msx-2 xhox7.1' msx |
pCMV-sport6.1 |
NISC_mq09g02.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5308202 5', MRNA sequence
gi|21077502|gb|BQ389815.1|[21077502]
NISC_mq09g02.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5308202 3', MRNA sequence
gi|21077501|gb|BQ389814.1|[21077501]
|
EcorI/T7 |
| Msx2 |
203 |
msx2 xhox7.1 |
CS107 |
Tgas001O13 |
EcorI/T7 |
| Myf-5 |
128 |
xMyf5 myf 5 myf-5 xmyf-5 |
CS107 |
TGas046013 This was supposed to be flk-1. Sequencing and in situ suggest
that it is xMyf-5 |
BamHI/T7* |
| myf5 |
132 |
myf myf-5 |
CS107 |
Tgas042G05 |
BamHI/T7 |
| Myod |
5 |
Myod myod |
CS107 |
Tneu010F7 |
T7 BamH1 (not Ecor1) |
| Myod |
8 |
Myod myod |
CS107 |
Tneu142K23 |
T7 BamH1 (not Ecor1) |
| Myod |
9 |
Myod myod |
CS107 |
Tneu016C22 |
T7 BamH1 (not Ecor1) |
| Myod |
10 |
Myod myod |
CS107 |
Tneu017H11
RI/BamHI cut inside clone
*this clone has been tested and works for in situ |
T7/Cla1* |
| Myod |
15 |
Myod myod |
CS107 |
Tneu057J16 |
T7 BamH1 (not Ecor1) |
| Myod |
17 |
Myod myod |
CS107 |
Tneu065C7 |
T7 BamH1 (not Ecor1) |
| NCAM |
226 |
NCAM neural cell adhesion molecule |
CS107 |
TTpA054a02 |
claI/T7 |
| NDGR1 |
252 |
ndrg1 |
pCMV-SPORT6.1 |
dbEST Id: 19452376
EST name: AGENCOURT_15097956
GenBank Acc: CF238475
GenBank gi: 33441683
CLONE INFO
Clone Id: IMAGE:6993295 (5') |
|
| NDRG1 |
267 |
|
pRKW2 |
dbEST Id: 20094268
EST name: AGENCOURT_15973246
GenBank Acc: CF783804
GenBank gi: 37746575
CLONE INFO
Clone Id: IMAGE:7026048 (5' |
|
| Neural Specific Tubulin |
52 |
neural specific tubulin n-tubulin beta-tubulin tubulin n tubulin ntubulin |
CS107 |
Tneu143I02
Note this clone is chimeric. The 5' end of this clone is the full length tropicalis neural specific tubulin (~1.7kb). However a portion (about 1.1kb) of 18S sequence is fused to the 3' end of the tubulin clone (same orientation). Therefore this clone is NOT suitable for in situs. |
T7 Ecor1 |
| Neural specific tubulin |
98 |
neural specific tubulin n-tubulin beta-tubulin tubulin n tubulin ntubulin |
pGEM-5Zf(-) 3 kb |
Clone #52 was partially digested with Nde I (cuts about 21 bp into 18S RNA sequence and then somewhere in CS107 which liberates all of tubulin flanked on the 5'end with some CS107 and then on the 3'end with 21 bp of 18S sequence). [Nde I also cuts in n-tubulin. ] This fragment was purified and then cut with NcoI.
NcoI-NdeI ntubulin cloned into the NcoI-NdeI site of pGEM-5Zf(-)
5' end is at NcoI site- 3'end is NdeI site
*Probe made |
apa I/Sp6* |
| NeuroD |
285 |
neuroD |
pCMV-Sport6.1 |
AGENCOURT_14926246 NICHD_XGC_Emb7 Xenopus tropicalis cDNA cloneIMAGE:6979104 5', mRNA sequence. ACCESSION CF149433
/clone="IMAGE:6979104"
/tissue_type="tailbud"
/dev_stage="embryo, stages 20-27"
/lab_host="DH10B (phage-resistant)"
/clone_lib="NICHD_XGC_Emb7"
/note="Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV; |
kpnI/T7 |
| Neurogenin |
286 |
neurogenin-1 |
pCMV-sport6.1 |
/clone="IMAGE:6977515"
/tissue_type="tailbud"
/dev_stage="embryo, stages 20-27"
/lab_host="DH10B (phage-resistant)"
/clone_lib="NICHD_XGC_Emb7"
/note="Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV;
AGENCOURT_15069957 NICHD_XGC_Emb7 Xenopus tropicalis cDNA clone
IMAGE:6977515 5', mRNA sequence.
ACCESSION CF224521
VERSION CF224521.1 GI:33425229 |
kpnI/T7 |
| neurogenin-related |
284 |
neurogenin-2 neurogenin related 1 |
CS107 |
the insert from IMAGE clone 7093678 was cut with XhoI-NotI and cloned
into the XhoI and NotI sites of pbs KS II. |
NotI/T7 |
| Nkx |
143 |
nkx |
CS107 |
unclear which nkx. needs to be sequenced
Tneu010A20 |
|
| Nkx |
215 |
|
CS107 |
Tneu105p04 |
|
| Nkx2.1 |
228 |
Nkx2.1 Nkx-2.1 |
pCRII-topo |
orientation is SP6 3' Nkx2.1 5' T7 |
NotI/SP6* |
| Nkx2.4 |
229 |
nkx-2.4 nkx2.4 |
pCRII-topo |
orientation is SP6 3' Nkx2.4 3' T7 |
NotI/Sp6* |
| Nkx2.5 |
113 |
nkx nkx2.5 |
pCR2.1-topo 3.9 kb |
|
BamHI/T7* |
| nkx6.1 |
127 |
nkx |
CS107 |
Tegg079m07 |
claI/T7 |
| Noelin |
208 |
noelin |
CS107 |
Tneu071d23 |
|
| nog1 |
140 |
noggin nog |
CS108 |
|
ClaI/T7 |
| Noggin2 |
260 |
noggin-2 noggin2 |
CS107 |
EST name: AL792266
GenBank Acc: AL792266
GenBank gi: 38314390
CLONE INFO
Clone Id: TNeu122a14 (5')
Xenopus tropicalis noggin 2 mRNA, complete cds
gi|50982267|gb|AY672092.1|[50982267]
|
|
| Nrp-1 |
62 |
NRP1 nrp-1 |
CS107 |
Genbank #BG512402
*this clone has been tested and works for in situ |
RI/T7* |
| ODC |
105 |
odc ornithine decarboxylase |
CS107 |
|
|
| Olig1 |
299 |
olig1 olig-1 |
pCMVsport6 |
DEFINITION JGI_CAAL9004.fwd NIH_XGC_tropBrn4 Xenopus tropicalis cDNA clone
IMAGE:7666629 5', mRNA sequence.
ACCESSION CX852777
VERSION CX852777.1 GI:58510630
Site_1: SalI; Site_2: NotI |
|
| olig2 |
130 |
olig2 olig-2 olig |
CS107 |
Tneu076F16
This clone pulls up chick olig2 as the first hit with tblastx. The next hit is human olig3. |
EcoRI/T7* |
| olig2 |
133 |
olig olig-2 olig2 |
CS107 |
Tneu063G03
sequencing was not very good but does pull up olig2 with tblastx. |
|
| olig3 |
124 |
olig OLIG OLIG3 |
CS107 |
no 5'
3' uncertain
TGas060e07 |
|
| Optx2 |
232 |
optx-2 optx2 eye six3 |
CS107 |
TTp042O24 |
T7/ClaI |
| Osr1 |
312 |
osr-1 osr1 odd skipped related 1 |
pCS107;Site1:EcoRI;Site2:NotI
|
This insert is inverted!
LOCUS CR761835 1170 bp mRNA linear VRT 15-SEP-2004
DEFINITION Xenopus tropicalis finished cDNA, clone TGas143j06.
ACCESSION CR761835
|
xhoI/T7 |
| OTX2 |
29 |
OTX2 otx2 otx Otx2 |
CS107 |
Tgas025F18 |
T7 Ecor1 |
| OTX2 |
31 |
otx2 Otx2 OTX2 otx |
CS107 |
LIG12G10
AL643588
*this clone has been tested and works for in situ |
T7 Ecor1* |
| Otx5b |
283 |
Otx5b |
CS107 |
|
t7/claI |
| Pax1 |
261 |
pax-1 pax1 |
CS107 |
gi|38395761|gb|BX723020.1|BX723020 BX723020 XGC-tadpole
Xenopus tropicalis cDNA clone TTpA029e07 5', mRNA
FL
gi|38417752|gb|BX745012.1|BX745012 BX745012 XGC-tadpole
Xenopus tropicalis cDNA clone TTpA033a05 5', mRNA sequence
I am not sure which |
|
| Pax2 |
114 |
pax pax-2 pax2 |
CS107 |
BamHI digest/T7 works for in situ. However BamHI digest does produce a second small band 600bp. |
T7/ClaI* |
| PAX3 |
79 |
PAX 3 Pax3 Pax-3 |
CS107 |
Tneu031e04 |
BamHI/T7* |
| pax3 |
129 |
psx pax-3 pax3 |
CS107 |
Clone TNeu048L09 |
|
| Pax6 |
182 |
pax-6 pax6 |
pCMV-sport6.1 |
AGENCOURT_15156619 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:6992220 5', MRNA sequence
gi|33604574|gb|CF264195.1|[33604574]
|
RI/T7* |
| Pax8 |
131 |
pax pax-8 pax8 |
pBS KS II |
approximately 950bp of x.trop pax8 was amplified using the following primers:
ggaattccGGTCACGGAGGTTTGAATCAGTTAG
cgggatcccgTGGGGCTACATAAAGATGAAGGG
which also places an EcoRI site at the 5'end and a BamHI site at the 3'end.
This was amplfiied using Pfu from 25-30 stage x.trop cDNA
Amplicon was cloned into the RI-BamHI site of pBS KS II. |
RI/T7* |
| Pax8 |
214 |
pax8 pax-8 |
CS107 |
dbEST Id: 19437795
EST name: AGENCOURT_15067591
GenBank Acc: CF223950
GenBank gi: 33424658
CLONE INFO
Clone Id: IMAGE:6977138 (3') |
|
| PiI |
241 |
Protein phosphatase inhibitor / IPP-1 PiI endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19304699
EST name: AGENCOURT_14929377
GenBank Acc: CF147950
GenBank gi: 33244218
CLONE INFO
Clone Id: IMAGE:6979822 (5') |
|
| Protein phosphatase-1 gamma 1 |
153 |
|
CS107 |
we thought this was sfrp2 but it ain't |
|
| Prox1 |
319 |
prox-1 prox1 lymphatic |
PCR2.1 topo |
Prox1 fragment amplified by PCR. Cloned into topo kit vector PCR2.1 topo and is flanked by EcoRI sites. |
KpnI/T7 |
| Rfx4v3.sport6 |
282 |
Rfx4v3 |
sport6 |
|
t7/ |
| sam68 |
248 |
RNA-binding KH domain / Sam68 endoderm |
pCMV-SPORT6.1 |
dbEST Id: 19453200
EST name: AGENCOURT_15099032
GenBank Acc: CF239298
GenBank gi: 33442506
CLONE INFO
Clone Id: IMAGE:6995540 (5') |
|
| Sek1/ EphA4 |
34 |
sek1 sek SEK Sek1 Sek EphA4 eph |
CS107 |
Tneu011C01
*this clone has been tested and works for in situ |
T7/Ecor1* |
| sfrp-2 |
146 |
secreted frizzled related sfrp sfrp2 sfrp-2 |
CS107 |
Tneu137h23 |
T7/ClaI |
| sfrp-2 |
149 |
secreted frizzled related sfrp2 sfrp-2 sfrp |
CS107 |
TNeu109a23
3' end sequencing does not appear to be sfrp-2 |
|
| SHH |
12 |
shh SHH sonic hedgehog |
CS107 |
Tneu023N4
*this clone has been tested and works for in situ |
T7/BamH1* |
| SHH |
18 |
SHH shh sonic hedgehog |
CS107 |
Tneu067O14
*this clone has been tested and works for in situ |
T7-BamH1* |
| Siamois |
41 |
siamois Siamois SIAMOIS |
CS107 |
Tgas088L16
T7 (not Ecor1, BamH1, or HindIII) - cla1 |
T7/ClaI* |
| Six1 |
224 |
six-1 six1 sine oculis homeobox |
CS107 |
TNeu098p21 |
|
| Sizzled |
147 |
sizzled |
CS107 |
Tneu024k17 |
|
| Sizzled |
148 |
sizzled |
CS107 |
Tgas144c13 |
ClaI/T7* |
| Slug |
35 |
SLUG slug Slug |
CS107 |
Tneu008A21
Likely have 3' also
*this clone has been tested and works for in situ |
T7/BamH1* |
| Slug |
37 |
SLUG slug Slug |
CS107 |
Tneu006i21
LIkely have 3' also |
|
| smad1 |
60 |
smad1 smad-1 |
CS107 |
Genbank ID#BG346829 |
|
| SMAD10 |
117 |
smad10 smad |
CS107 |
TGas037H15
3' not present |
claI/T7 |
| snail |
211 |
snail |
CS107 |
Tgas026k15 |
claI/T7 |
| Sox 2 |
75 |
Sox-2 sox sox2 |
CS107 |
Tgas061h22
|
ClaI/T7* |
| Sox-2 |
76 |
Sox-2 sox sox2 |
CS107 |
Tneu054c10
NOTE: This clone gives tons of background when used for in situ probe. (ClaI/T7)
Use #75 instead |
Do not use |
| sox-3 |
59 |
sox-3 sox3 sox xsox3 |
CS107 |
Genbank ID#BG512766
*this clone has been tested and works for in situ |
RI/T7* |
| Sox-D |
57 |
sox soxD sox D sox-D |
CS107 |
Genbank ID# BG348615
*this clone has been tested and works for in situ |
RI/T7* |
| sox1 |
134 |
sox 1 sox-1 |
CS107 |
TNeu023i18 |
HindIII/T7 |
| sox1 |
135 |
sox 1 sox-1 |
CS107 |
TGas002m12 |
HindIII/T7 |
| Sox1 truncated UTRs |
320 |
Sox1 |
pBS bluescript |
I want to test if the UTR regions of the trop Sox1 gene are suppressing activity. This version has most of the UTRs removed. I will use this to transfer the Sox1 gene into pCS108 using Sal1 and Not1 which will then be used for mRNA production. |
|
| sox10 |
209 |
sox10 sox-10 |
CS107 |
Tneu062e04 |
claI/T7 |
| Sox14 |
317 |
XtSox14, Sox 14, Sox-14 |
CS107 |
Sox14 was cloned by PCR from tropicalis genomic DNA (single exon gene) and cloned into TOPO vector. It was subcloned into the EcoRI sites of pCS107 and confirmed by restriction digest and by sequencing to be full-length. the sequence completely matches the entire coding sequence of the Sox14 genomic sequence (JGI). |
BamHI/T7 |
| Sox17-alpha |
239 |
sox17alpha sox17-alpha sox17 alpha |
pCMV-SPORT6.1 |
dbEST Id: 19451901
EST name: AGENCOURT_15100518
GenBank Acc: CF238000
GenBank gi: 33441208
CLONE INFO
Clone Id: IMAGE:6994003 (5')
Plate: LLAM14675 Row: f Column: |
kpnI/T7* |
| Sox17-b |
238 |
sox17beta sox17-beta sox17 beta |
pCMV-SPORT6.1 |
dbEST Id: 12437211
EST name: NISC_mq24b08.y1
GenBank Acc: BQ392386
GenBank gi: 21080073
CLONE INFO
Clone Id: IMAGE:5309151 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11783 Row: D Column: 16 |
|
| Sox17beta |
58 |
sox sox-17 sox17 xsox17 beta |
CS107 |
Genbank ID#BG886038
**this clone has been tested and works for in situ |
RI/T7* |
| Sox21 |
316 |
Sox 21, sox-21, Tneu058o20 |
CS107 |
Tneu058o20 |
EcoRI/T7 |
| Sox9 |
274 |
sox-9 sox9 |
CS107 |
LOCUS CR855424 2520 bp mRNA linear VRT 03-NOV-2004
DEFINITION Xenopus tropicalis finished cDNA, clone TNeu111f21.
|
BsrgI/T7 |
| sprouty4 |
295 |
sprouty4 sprouty-4 |
pCMVsport6 |
DEFINITION JGI_CAAM7345.fwd NIH_XGC_tropTe3 Xenopus tropicalis cDNA clone
IMAGE:7681047 5', mRNA sequence.
ACCESSION CX897186
VERSION CX897186.1 GI:58636530
Site_1: SalI; Site_2: NotI |
kpnI/T7 |
| steel |
266 |
kit ligand steel-2 stem cell factor scf |
pCMV-SPORT6.1 |
>gi|33604368|gb|CF263989.1|CF263989 AGENCOURT_15157184 NICHD_XGC_Emb6 Xenopus tropicalis cDNA clone
IMAGE:6991375 5' |
|
| Tannabin |
292 |
tannabin cartilage |
pCS108 |
DEFINITION JGI_XZT32954.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone IMAGE:7608922 5', mRNA sequence.
ACCESSION CX410332
VERSION CX410332.1 GI:57191034
Site_1: SalI; Site_2: NotI; Tadpole
library constructed by Russell B. Fletcher in R. Harland's lab using poly A RNA and oligo dT primers (Invitrogen SuperScript Plasmid System for cDNA Synthesis and Cloning). SalI (5' end) -NotI (3' end) cDNA was inserted into vector pCS108 |
|
| Tannabin |
293 |
tannabin |
pCMVsport6 |
DEFINITION JGI_CAAM7280.fwd NIH_XGC_tropTe3 Xenopus tropicalis cDNA clone
IMAGE:7681030 5', mRNA sequence.
ACCESSION CX897063
VERSION CX897063.1 GI:58636407
Site_1: SalI; Site_2: NotI; |
|
| Tie-1 |
301 |
tie-1 tie1 vascular |
pCMVsport6 |
DEFINITION JGI_CAAN1643.fwd NIH_XGC_tropTe4 Xenopus tropicalis cDNA clone
IMAGE:7687301 5', mRNA sequence.
ACCESSION CX909068
VERSION CX909068.1 GI:58648412
Site_1: SalI; Site_2: NotI |
|
| tie-2 |
300 |
tie-2 tie2 vascular |
CS107 |
DEFINITION JGI_CABE1423.fwd NIH_XGC_tropOva1 Xenopus tropicalis cDNA clone
IMAGE:7820350 5', mRNA sequence.
ACCESSION DN086803
VERSION DN086803.1 GI:59752081
Site_1: EcoRI; Site_2: XhoI |
|
| Tie1 |
297 |
tie-1 tie1 vascular |
pCS108 |
DEFINITION JGI_XZT72863.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7791938 5', mRNA sequence.
ACCESSION CX340557
Site_1: SalI; Site_2: NotI
Initially I thought this clone was Tie2 |
|
| Tie1 |
303 |
tie-1 tie1 |
pCMVsport6 |
DEFINITION JGI_CAAN3978.fwd NIH_XGC_tropTe4 Xenopus tropicalis cDNA clone
IMAGE:7689565 5', mRNA sequence.
ACCESSION CX913408
VERSION CX913408.1 GI:58703164
Site_1: SalI; Site_2: NotI |
|
| TSG2 |
233 |
tsg2 tsg-2 twisted gastrulation 2 |
pCMV-sport6 |
gi|36346316|gb|CF593113.1|CF593113 AGENCOURT_15703772
NICHD_XGC_Swb1N Xenopus tropicalis cDNA clone IMAGE:7025399 5' |
kpnI/T7 |
| tubulin-alpha |
104 |
alpha tubulin |
CS107 |
|
|
| Twist |
44 |
Twist twist TWIST |
CS107 |
Tneu085G21 |
|
| Twist |
45 |
Twist twist TWIST |
CS107 |
Tneu125e01
|
T7 Ecor1 |
| Twist |
47 |
Twist twist TWIST |
CS107 |
Tneu076A5 |
|
| Twist |
48 |
Twist twist TWIST |
CS107 |
Tneu143K24 |
|
| Twist |
49 |
Twist twist TWIST |
CS107 |
Tneu075H18
*this clone has been tested and works for in situ |
T7/Ecor1* |
| Twist |
50 |
Twist twist TWIST |
CS107 |
Tneu099J15 |
|
| Twist |
51 |
Twist twist TWIST |
CS107 |
Tneu141P24 |
T7 Ecor1 |
| twisted gas |
88 |
twisted gastrulation tsg |
CS107 |
Tgas066i20
THIS APPEARS TO BE A CHIMERIC CLONE. USE RECORD #91 INSTEAD! |
|
| twisted gas |
91 |
twisted gastrulation tsg |
CS107 |
Tgas012m12 |
claI/T7* |
| VegF |
178 |
vegF |
CS107 |
Tegg015L19 |
ClaI/T7* |
| Vegfr2 |
296 |
vegfr2 vegfr3 vegfr-2 vascular |
pCMVsport6 |
DEFINITION JGI_CAAM1546.fwd NIH_XGC_tropTe3 Xenopus tropicalis cDNA clone
IMAGE:7675709 5', mRNA sequence.
ACCESSION CX887487
Site_1: SalI; Site_2: NotI;
This clone has high sequence similarity to both vegfr2 and vegfr3 |
|
| Vegfr2 |
298 |
vegfr2 vegfr-2 vascular |
pCMVsport6 |
DEFINITION JGI_CAAJ18374.fwd NIH_XGC_tropBrn2 Xenopus tropicalis cDNA clone
IMAGE:7648284 5', mRNA sequence.
ACCESSION CX807538
VERSION CX807538.1 GI:58362165
Site_1: SalI; Site_2: NotI;
|
|
| VegT |
93 |
veg vegT |
CS107 |
TGas066f22
*Have in situ probe |
BamHI/T7* |
| VegT |
94 |
vegT veg |
CS107 |
TGas032N19 |
|
| Vent-1 |
56 |
vent vent-1 vent 1 xvent 1 |
CS107 |
Genbank ID# BG487195
*this clone has been tested and works for in situ |
RI/T7* |
| Vent-2 |
66 |
xvent Vent 2 vent-2 |
CS107 |
BG885317
*Tested and works for in situ |
T7/Ecor1* |
| Vent-2 |
159 |
vent-2 vent vent2 |
CS107 |
Tgas046D19 |
|
| vent-2 |
168 |
vent vent2 vent-2 |
CS107 |
Tgas019L23 |
|
| VEX-1 |
86 |
xVEX-1 vex1 vex xvex |
CS107 |
Tneu044o05 |
claI/T7 |
| Vg1 |
201 |
Vg1 |
CS107 |
Tegg053L11 |
T7/ClaI |
| Vito |
262 |
vito |
CS107 |
TGas048e14
AL646219 XGC-gastrula Xenopus tropicalis cDNA clone TGas048e14 |
|
| Vito |
263 |
vito |
CS107 |
|
|
| VSX1 |
230 |
vsx-1 vsx1 |
pCRII-topo |
T7 5' vsx-1 3' Sp6 |
Sp6/NotI |
| wnt-8 |
145 |
wnt wnt8 wnt-8 |
CS107 |
TGas015M15 |
ClaI/T7 |
| wt1 |
309 |
wt-1 wt1 wilms tumor-1 |
pCMV-SPORT6 |
DEFINITION AGENCOURT_15189827 NICHD_XGC_Sp1 Xenopus laevis cDNA clone
IMAGE:5512168 5', mRNA sequence.
/note="Organ: spleen; Vector: pCMV-SPORT6; Site_1: NotI;
Site_2: SalI |
kpnI/T7 |
| XAG |
99 |
XAG XAG-1 XAG-1 cement gland |
pCMV-SPORT6.ccdb |
dbEST Id: 12436621
EST name: NISC_mq20g05.y1
GenBank Acc: BQ391796
GenBank gi: 21079483
CLONE INFO
Clone Id: IMAGE:5309001 (5')
Source: IMAGE Consortium, LLNL
Cloned into Not I/RV site |
Kpn I/T7 |
| XAG-2 |
78 |
XAG-2 xag2 |
CS107 |
Tneu029o22
*Probe works (has been tested) |
Bamh1/T7* |
| XAG-2 |
85 |
XAG-2 xag2 xag 2 |
CS107 |
Tneu033f09 |
|
| Xanf-1 |
141 |
xanf1 xanf-1 |
CS107 |
Tneu069M07 |
claI/T7 |
| XBF-1 |
227 |
xBF-1 xbf1 bf-1 bf1 fox forkhead FoxG1 brain factor |
pCRII-topo |
orientation is Sp6 5' xbf-1 3' T7 |
BamHI/T7* |
| XBra |
24 |
xbra x-bra brachyury |
CS107 |
Tneu024F07 (didn't cut with Ecor1/Not1) |
T7 BamH1 |
| XBra |
30 |
xbra BRA XBRA Xbra bra |
CS107 |
Tgas023E12
*this clone has been tested and works for in situ |
T7 Ecor1* (not BamH1) |
| XBra |
33 |
xbra XBRA bra XBra |
CS107 |
Tgas020F02
Maybe have 3' of gene |
T7 Ecor1 |
| Xcad1 |
273 |
xcad1 cad1 cad-1 |
pRKW2 |
EST name: AGENCOURT_15774575
GenBank Acc: CF781041
GenBank gi: 37740993
CLONE INFO
Clone Id: IMAGE:7028114 (5') |
|
| Xcad1 |
276 |
xcad1 cad1 cad-1 |
pCMV-SPORT6.1 |
LOCUS BC063344 2777 bp mRNA linear VRT 23-AUG-2004
DEFINITION Xenopus tropicalis cad1, mRNA (cDNA clone MGC:75839 IMAGE:5382575),
complete cds.
ACCESSION BC063344
VERSION BC063344.1 GI:38648966 |
|
| xcad3 |
314 |
xcad3 xcad-3 |
CS107 |
LOCUS BX755473 551 bp mRNA linear EST 10-DEC-2003
DEFINITION BX755473 XGC-gastrula Xenopus tropicalis cDNA clone TGas108b24 3',
mRNA sequence.
pCS107; Site_1: EcoRI; Site_2: NotI |
claI/T7 |
| Xelk |
180 |
eph receptor |
pCMV-sport6.1 |
>gi|21078016|gb|BQ390329.1|BQ390329 NISC_mq12f01.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone
IMAGE:5308177 5'. |
XmaI/T7 |
| XFD-1 |
138 |
xfd1 foxa4a foxa4 pintallavis xfkh1 |
CS107 |
|
BamHI/T7 |
| XFD-12 |
160 |
xfd12 xfd-12 foxd5 fkhd forkhead fox |
CS107 |
Tgas055d21 |
claI/t7 |
| XFD11 |
156 |
xFD11 foxc1 fkhd forkhead fox |
CS107 |
Tgas132N18 |
|
| XFD12 |
158 |
xfd12 xfd-12 foxd5 fkhd forkhead fox |
CS107 |
Tgas063B23 |
|
| XFD13 |
272 |
xfd13 FoxF1b fox |
CS107 |
Tneu093i16 |
|
| XFD13 |
275 |
xfd13 FoxF1b fox |
CS107 |
Ttpa071G02 |
|
| xFd4 |
165 |
fkhd forkhead fox xfd4 FoxC2 |
CS107 |
Tneu106J02 |
|
| XFD4 |
170 |
fkhd forkhead foxC2 XFD4 XFD-4 |
CS107 |
Tneu075J16 |
|
| xHex |
63 |
Hex xhex |
CS107 |
Genbank #BG815569
Note this clone is in reverse orientation so that the 5' end is at the Not I site and
the 3' end is at the RI site
This probe never worked for in situ |
|
| xHex |
107 |
thex hex |
CS107 |
TGas075h17
|
BamHI/T7* |
| xhr1 |
278 |
xhr1 esr1 hairy enhancer of splir |
pCMV-SPORT6.1 |
LOCUS BC075553 1298 bp mRNA linear VRT 20-SEP-2004
DEFINITION Xenopus tropicalis MGC89494 protein, mRNA (cDNA clone MGC:89494
IMAGE:6992227), complete cds.
ACCESSION BC075553
VERSION BC075553.1 GI:49523070 |
claI/T7 |
| xIro1 |
223 |
xIro1 Iro1 iroquois1 iro-1 xiro-1 |
CS107 |
TNeu022p19 |
claI/T7 |
| Xiro3 |
225 |
xiro3 iro3 xiro-3 iro-3 iroquois |
CS107 |
TTpA012p20 |
|
| xKRK1 |
256 |
krk1 xkrk-1 xkrk1 |
pCMV-SPORT6.1 |
EST name: NISC_mq06f10.y1
GenBank Acc: BQ389278
GenBank gi: 21076965
CLONE INFO
Clone Id: IMAGE:5307787 (5') |
AgeI/T7 |
| xLim1 |
234 |
lim-1 lim1 |
CS107 |
|
clai/t7 |
| XNOT |
118 |
xnot not XNot |
CS107 |
3' end not present...maybe not be xnot
tneu017e01 |
claI/T7 |
| Xnr-1 |
265 |
Xnr1 Xnr-1 nodal related |
CS107 |
TGas124h10 |
|
| XNR3 |
22 |
xnr3 XNR3 x-nr3 |
CS107 |
Tgas011k18 |
T7 Ecor1 |
| Xnr3/EcorV- |
311 |
Xnr3delta EcorV, Xnr3 MO- |
CS107 |
this is our Xnr3 trop construct in CS107 digested with EcorV to remove most of the MO binding site from the 5' UTR (leaves 8bp of 25). then re-ligated and transformed. sequenced 7/11/05 |
T7 Ecor1 |
| Xolloid |
197 |
xolloid tolloid |
CS107 |
Tneu125J24 |
T7/ClaI |
| Xpat |
240 |
Xpat |
pRKW2 |
dbEST Id: 20092089
EST name: AGENCOURT_15890534
GenBank Acc: CF781625
GenBank gi: 37742192
|
|
| Xrx1 |
217 |
|
CS107 |
dbEST Id: 19453395
EST name: AGENCOURT_15097667
GenBank Acc: CF239493
GenBank gi: 33442701
CLONE INFO
Clone Id: IMAGE:6995420 (5') |
|
| Zic2 |
28 |
Zic2 zic2 zic Zic |
CS107 |
Tgas015E14
*this clone has been tested and works for in situ |
T7/BamHI* |
| Zic5 |
81 |
Zic 5 Zic5 zic-5 |
CS107 |
Tgas042c07
|
|
| Zic5 |
92 |
zic5 zic 5 zic-5 |
CS107 |
TGas041c07 |
|
