Trop Team
Search Harland trop site
Obtain Embryos
Genomic Resources
Trop Labs

Harland Lab Trop Plasmid Library

To obtain clones, email harland@socrates.berkeley.edu

Note: Due to a MTA, clones that are from the Wellcome Trust and sequenced by the Sanger are available at Geneservice. The clone ID begins with Tneu, Tegg, or Tgas. We cannot distribute these clones so please obtain them from the Geneservice.

Last updated 10/27/05

Please use the find command in your browser to search for clones

Plasmid name Record number Other names Vector Purpose and notes Antisense
a-tubulin 269 alpha tubulin pCMV-SPORT6.1 BC061297
Xenopus tropicalis tubulin, alpha 1, mRNA (cDNA clone MGC:75767 IMAGE:5381815), complete cds
gi|38511929|gb|BC061297.1|[38511929]
internal RI/notI site

a1-ATPasea 250 a1-ATPase alpha1-ATPase Na/K ATPase a1 subunit endoderm pCMV-SPORT6.1 dbEST Id: 19434432
EST name: AGENCOURT_15040604
GenBank Acc: CF220660
GenBank gi: 33421368

CLONE INFO
Clone Id: IMAGE:6988026 (5')
KpnI/T7*
Activin beta b subunit 196 activin CS107 Tneu142F12
ADMP1 304 ADMP CS107 CS107 prepped version of clone Tgas066c03
sequenced 6/24/05

Do NOT use:
Ecor1
bamH1
hindIII
XbaI
T7 Cla1
ADMP1/pcmv 305
pCMV Sport 6.1 sequence confirmed 6/24/05
prep of Image clone 6990706, intended for subcloning into CS108 for probe/mRNA
can also use record #304 for same purpose


ADMP2 290 ADMP2 CS107 CS107 this is a prep from ordered clone number Tneu087d02.
sequence verified
in situ pattern is faint; anterior neural.

T7/BamH1
alpha tubulin 181 tubulin a-tubulin alpha tubulin pCMV-sport6.1 >gi|33245881|gb|CF149613.1|CF149613 AGENCOURT_14929401 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone
IMAGE:6980422 5'.

We thought this was gridlock but seq. confirms that it is tubulin
kpnI/T7
ap2 210 ap2 ap-2 CS107 Tgas030K20 claI/T7
Axial protocadherin 137 apc axial protocadherin CS107 Tegg092J24
3' end not all there
EcoRI/T7*
Axial protocadherin 139 apc axial protocadherin CS107 Tegg017F14 EcoRI/T7
Axin related 199 axin related CS107 Tneu129J09
The first few nucleotides may be missing in this clone - just short of full length

BAMBI 195 bambi CS107 Tegg028M12 T7/ClaI*
BAMBI 198
CS107 TEgg127M13 T7/ClaI
beta-catenin 236 beta-catenin b-catenin catenin CS107

BMP2 202 bmp2 bmp-2 bone morphogenetic protein 2 CS107 Tegg105I19 T7/ClaI*
BMP2 207 bmp2 bmp-2 CS107 Tgas025A06
BMP4 193 bmp-4 bmp4 bone morphogenetic protein4 CS107 Tneu045C17

This clone has a very short insert.
T7/ClaI
BMP4 194 bmp-4 bmp4 bone morphogenetic protein4 CS107 Tneu059F22

This clone also has a very short insert
T7/ClaI
BMP4 212 bmp 4 bmp-4 bmp4 bone morphogenetic protein CS107 Tneu015d14 claI/t7
bmp4 231 bmp4 bmp-4 bone morphogenetic protein CS107 Tgas125E13 claI/T7
BMP7 61 BMP BMP-7 BMP7 bmp7 bmp-7 bmp-7R CS107 Genbank ID#BG514944


bamH1 (t7) ok as well - NOT hind III
*this clone has been tested and works for in situ

This clone encodes a protein more similar to "BMP-7R" of X. laevis than to "BMP-7," see Wang et al. 1997, Genes and Function for comparison of proteins.
see also clone 306 "BMP7-new"
RI/T7*
BMP7 new 306 BMP7 pCMV, pCMV sport 6.1 prepped version of IMAGE 5384686.
this is a better match to the "real" BMP7 (see Wang, Moos 1997, Genes and Function) than our clone #61 BMP7 (BMP7R).
This has been CS110K, record #310, but 306 also makes a fine probe
sequence confirmed 6/24/05
do NOT use Ecor1
T7/kpn1
BMP7-CS110K 310 BMP7 CS110K this is the "real" BMP7 of record 306 subcloned into Maura's 110K vector.
Kanamycin selection!!
do not use not1
do not use
(some restriction sites are inverted vs. record 306 following recombination reaction)
T7
C3 246 Complement C3 edoderm pCMV-SPORT6.1 dbEST Id: 19453773
EST name: AGENCOURT_15100521
GenBank Acc: CF239870
GenBank gi: 33443078

CLONE INFO
Clone Id: IMAGE:6994794 (5')

Cart-1 291 cart1 cart-1 cartilage pCMVsport6 LOCUS CX939893 849 bp mRNA linear EST 07-FEB-2005
DEFINITION JGI_CAAO6836.fwd NIH_XGC_tropTe5 Xenopus tropicalis cDNA clone
IMAGE:7703480 5', mRNA sequence.
ACCESSION CX939893
VERSION CX939893.1 GI:58729651

Site_1: SalI; Site_2: NotI;
KpnI/T7
Cerberus 21 Cerberus cerberus CS107 LIG10F05
AL638969
T7/BamH1 *(not Ecor1)
Cerberus 36 cerberus Cerberus CERBERUS CS107 Tgas016C17 T7 BamH1 (not Ecor1)
Ches1 163 fkhd forkhead fox ches1 FoxN3 CS107 Tgas027E12
Chito 242 Chito endoderm Glycosyl hydrolases / di-N-acetylchitobiase pExpress-1 dbEST Id: 19634136
EST name: AGENCOURT_15324914
GenBank Acc: CF375459
GenBank gi: 34312903

CLONE INFO
Clone Id: IMAGE:7007227 (5')

For vector information see
http://zgc.nci.nih.gov/Vectors/vec_pexpress-1
For probe XmaI,EcoRI, RsrII T7

Chordin 1 Chordin chordin CS107 Tgas122K5
Chordin 3 Chordin chordin CS107 Tgas133K5 T7 Ecor1
Chordin 4 Chordin chordin CS107 Tgas083F21 T7 Ecor1
Chordin 6 Chordin chordin CS107 Tneu011C22 T7 Ecor1*
Chordin 7 Chordin chordin CS107 Tneu140P12 T7 Ecor1
Chordin 13 Chordin chordin CS107 Tneu029D7 T7 not R1 - use Bamh1
Chordin 14 Chordin chordin CS107 Tneu033C4 T7 Ecor1
Chordin 16 Chordin chordin CS107 Tneu005F12 T7 Ecor1
Chordin 19 Chordin chordin CS107 Tneu080L20 T7 Ecor1
Churchill 222 churchill CS107 TTpA047h20 BamHI/T7*
Collagen A Type II 288 Collagen II A pCMV-SPORT6.1 ACCESSION BC063191
full length sequence available
AgeI/T7
Coronin 55 coronin CS107 Genbank ID# BG512194
dad26g11.y1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4440788 5' similar to TR:Q9PWG8 Q9PWG8 CORONIN HOMOLOG. ;, MRNA sequence

cpl1 235 cpl1 cpl-1 lipocalin CS107 Cloned into assymetric SfI I sites. 5' EcorI NotI 3'

for probes linearize with EcoRI or Kpn I
T7/KpnI
Crescent 150 crescent frzb2 frzb-2 CS107 Tneu117G19 claI/T7
Crescent 151 crescent frzb2 frzb-2 CS107 Tneu018n22
3' end appears to be chimeric with translation initiation factor

Crescent 152 crescent frzb2 frzb-2 CS107 Tneu142G13
cytokeratin 270 cytokeratin epidermal keratin pCMV-SPORT6.1 EST name: AGENCOURT_15113715
GenBank Acc: CF240450
GenBank gi: 33443658

CLONE INFO
Clone Id: IMAGE:6991625 (3')
EcoRI/T7
cytokeratin 271 cytokeratin epidermal keratin pCMV-SPORT6.1 dbEST Id: 19309082
EST name: AGENCOURT_14905694
GenBank Acc: CF152092
GenBank gi: 33248600

CLONE INFO
Clone Id: IMAGE:6984581 (5')

Dazap2 96 Dazap-2 dazap2 proline-rich protein, 81E10 CS107
ClaI/T7
delta 281 delta sport6 Image clone 6988912 t7/kpn1
derriere 69 derriere CS107 Tgas141F11
*tested for in situ - works
RI/T7*
DG42 247 Hyaluronan synthase 1 DG42 endoderm pCMV-SPORT6.1 dbEST Id: 19434270
EST name: AGENCOURT_15041124
GenBank Acc: CF220501
GenBank gi: 33421209

CLONE INFO
Clone Id: IMAGE:6988222 (5')

dHAND 277 dHAND pCMV-SPORT6.1
EST name: AGENCOURT_14980561
GenBank Acc: CF218564
GenBank gi: 33419272

CLONE INFO
Clone Id: IMAGE:6989521 (5')

Dickkopf-1 2 Dickkopf-1 dickkopf1 dkk CS107 Tgas131C10 T7/R1*
BamH1 and HindIII ok too
DLL2 120 xdll2 dll DLL CS107 Likely have 3'
Don't have 5'
TGAS040e17

dll2 125 dll-2 DLL xdll2 CS107 no 5'
3' - not sure
TNeu022006
claI/T7
DLL3 116 dll3 dll CS107 don't have 5'
TNeu139d17
claI/T7
dlx2 307 dlx-2 pCMV-SPORT6.1 LOCUS NM_001008060 2508 bp DEFINITION Xenopus tropicalis dlx2-prov protein (dlx2-prov), mRNA.
ERSION NM_001008060.1 GI:56118495
LOCUS BC080947 2508 bp mRNA linear VRT 08-MAR-2005
DEFINITION Xenopus tropicalis dlx2-prov protein, mRNA (cDNA clone MGC:79639
IMAGE:6980076), complete cds.
ACCESSION BC080947 GI:51704086
Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV;

EF1alpha 103
CS108

Emx1 251 emx1 empty spiracles 1 forebrain pCMV-SPORT6.1 LOCUS BC074580 1377 bp mRNA linear VRT 25-JUN-2004
DEFINITION Xenopus tropicalis cDNA clone MGC:69381 IMAGE:5335247, complete
cds.

EST name: NISC_nl02b12.y1
GenBank Acc: BQ520008
GenBank gi: 21378877

CLONE INFO
Clone Id: IMAGE:5335247 (5'
Kpn1/T7*
emx1 254 emx-1 emx1 CS107 TNeu052k18

gi|38337578|gb|BX688458.1|BX688458 BX688458 XGC-neurula
Xenopus tropicalis cDNA clone TNeu052k18 3', mRNA sequence

emx2 255 emx-2 emx2 CS107 I am not sure which one.

gi|48676054|gb|CR407807.1|CR407807 CR407807 XGC-tailbud
Xenopus tropicalis cDNA clone TTbA001k13 5', mRNA sequence
Query= gi|38311649|gb|AL789146.2|AL789146 AL789146 XGC-neurula
Xenopus tropicalis cDNA clone TNeu125h20 5', mRNA sequence
claI/T7
emx3 188 emx3 pCMV-sport6.1 uncertain if emx1 or emx2


AGENCOURT_15065581 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:6978117 3', MRNA sequence
gi|33425498|gb|CF224790.1|[33425498]


AGENCOURT_15066333 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:6978117 5', MRNA sequence
gi|33425497|gb|CF224789.1|[33425497]

Asp718/T7*
En-1 318 engrailed1 engrailed-1 en1 en-1 PCR2.1 topo ~1000 bp PCR fragment was amplified and cloned using the TOPO TA kit into HindIII/T7
En-2 154 engrailed-2 en2 pCRII-TOPO 3950 nt an en-2 probe was amplified using the primers TGGGGAAGGAGATGCTTTGC
and TGGGCTGCTGAGAGGTTTTG.

pCRII-Topo also has a kanR cassette.

speI/T7*
Endocut 244 endocut Glutamate carboxypeptidase M20 endoderm pCMV-SPORT6.1 dbEST Id: 19435911
EST name: AGENCOURT_14995193
GenBank Acc: CF222137
GenBank gi: 33422845

CLONE INFO
Clone Id: IMAGE:6986243 (5')

Endodermin 100 edd endodermin pCMV-SPORT6.ccdb dbEST Id: 12638199
EST name: NISC_no19b07.y1
GenBank Acc: BQ526904
GenBank gi: 21385773

CLONE INFO
Clone Id: IMAGE:5381340 (5')
Source: IMAGE Consortium, LLNL


Endodermin 109 endodermin, edd CS107 dbEST Id: 12638199
EST name: NISC_no19b07.y1
GenBank Acc: BQ526904
GenBank gi: 21385773

CLONE INFO
Clone Id: IMAGE:5381340 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11971 Row: D Column: 13

Endodermin 219 endodermin pCMV-SPORT6.1
EST name: AGENCOURT_14928500
GenBank Acc: CF149137
GenBank gi: 33245405

CLONE INFO
Clone Id: IMAGE:6978356 (5')

antisense try RI or kpnI T7

Endothelin-1 287 entdothelin-1 endothelin1 CS107 TTpa039J07
Eomesodermin 204 eomesodermin CS107 Tgas141F06 RI/T7*
Eomesodermin 205 eomesodermin CS107 Tgas015D23
3' end gives no hits

Eph receptor tyrosine kinase 186 eph CS107 TGas045P01 ClaI/T7
EphB4 184 vascular ephb4 CS107 Tgas046K17 claI/T7*
EphB4 185 vascular ephb4 CS107 TNeu111K19 ClaI/T7
Ephrin b2 237 ephrin b2 pCMV-SPORT6.1 dbEST Id: 12435154
EST name: NISC_mq12f01.y1
GenBank Acc: BQ390329
GenBank gi: 21078016

CLONE INFO
Clone Id: IMAGE:5308177 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11780 Row: L Column: 2

EphrinB2 179 ephrin ephrinB2 ephrin-B2 pCMV-sport6.1 NISC_mq03c02.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5307266 5', MRNA sequence
gi|21076361|gb|BQ388674.1|[21076361]

NISC_mq03c02.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5307266 3', MRNA sequence
gi|21076360|gb|BQ388673.1|[21076360]

Asp718/T7
Epidermal Keratin 101 epidermal keratin keratin epidermis CS108 insert cloned into sal I-Not I
esr4 70 ESR4 esr CS107 Likely have 3'
Don't have 5'
TNeu125H16

ESR4 119 esr4 Esr4 CS107 5' not present
TNEU138e11

Fast1 164 fkhd forkhead fox Fast1 FoxH3 CS107 Tegg015N21
Fetuinish 249 Fetuinish Cystatin protease inhibitor / Fetuin-b endoderm pExpress-1 dbEST Id: 19889197
EST name: AGENCOURT_15703449
GenBank Acc: CF593173
GenBank gi: 36346442

CLONE INFO
Clone Id: IMAGE:7025331 (5')

FGF-8 220 fgf-8 fgf8 fibroblast growth factor 8 fgf pCMV-SPORT6.1 dbEST Id: 19308323
EST name: AGENCOURT_14904188
GenBank Acc: CF151333
GenBank gi: 33247841

CLONE INFO
Clone Id: IMAGE:6983047 (5')

antisense try RI or kpnI T7

FGF8 90 FGF8 fibroblast growth factor fgf-8 CS107 Tneu007i10
FGF8 95 fgf-8 fgf8 fibroblast growth factor CS107 TNeu007I10

*Been tested and works on in situ
T7/R1*
FGFR1 80 FGFR1 fibroblast growth factor receptor FGFR-1 CS107 Tneu049H18
FGFR2 77 FGFR2 FGFR fibroblast growth factor receptor FGFR-2 CS107 Tgas066A10
fgfr2 115 fibroblast growth factor receptor-2 fgfr CS107 AL637435
Don't have 5'
Clone Lig8c12

fgfr2 122 fgfr2 fibroblast growth factor receptor 2 fgfr-2 CS107 No 5'
TGas066a10

FGFR4a 87 FGFR4a fibroblast growth factor receptor FGFR-4a CS107 Tgas028m19
Fibronectin 64 fibronectin CS107 Genbank accession #BG886270
Fkh5 73 Fkh5 foxb1 forkhead5 forkhead-5 fkh-5 CS107 Tgas064p06
Fkh5 84 Fkh5 forkhead5 forkhead-5 fkh-5 CS107 Tgas053m03
Fkh6 83 fkh6 foxD3 forkhead6 forkhead-6 fkh-6 XFD6 CS107 Tgas035o17
Fli 302 fli vascular pCS108 DEFINITION JGI_XZT46477.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7621709 5', mRNA sequence.
ACCESSION CX342033
VERSION CX342033.1 GI:57078505
Site_1: SalI; Site_2: NotI

flk-1 294 flk1 vasciular flk-1 pCS108 DEFINITION JGI_XZT45538.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7620420 5', mRNA sequence.
ACCESSION CX341075
VERSION CX341075.1 GI:57077547

Site_1: SalI; Site_2: NotI;

follistatin 68 follistatin CS107 dad17g05.y1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4439985 5' similar to TR:Q91376 Q91376 FOLLISTATIN. ;.

BG348597
T7 Bamh1*(not R1)
forkhead 157 fkhd forkhead fox CS107 Tgas019F24
This clone has weak similarity to XFD2 (FoxI1a)

forkhead 175 fkhd forkhead fox

CS107 Tgas019F21
weak similarity to XFD2

Forkhead box I1 176 fkhd forkhead foxI1 pCMV-sport6.1 NISC_ng06a02.y1 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:5382411 5', MRNA sequence
gi|21081568|gb|BQ393881.1|[21081568]


Foxa2 136 fox foxa2 hnf3b hnf3beta hnf CS107 Tneu069I04 ClaI/T7*
FoxD3 216 foxd3 CS107 dbEST Id: 19434281
EST name: AGENCOURT_15040932
GenBank Acc: CF220512
GenBank gi: 33421220

CLONE INFO
Clone Id: IMAGE:6988210 (5'
SalI/T7
FoxI1 166 fkhd forkhead foxi1 XFD2 CS107 Tegg136P02
FoxI1 171 fkhd forkhead foxI1 XFD2 CS107 Tneu084P05
FoxI1a 23 xFD2 fox FoxI1a CS107 Tneu012H23 T7 Ecor1
FoxI1a 32 xFD2 fox FoxI1a CS107 Tgas002H16
Maybe have 5' of gene also

*this clone has been tested and works for in situ
T7 BamHI*
FoxI1c 162 FoxI1c fkhd forkhead fox XFD10 CS107 Tgas113F01
Foxi3 161 FoxI3 fkhd forkhead fox CS107 Tegg138H22
most similar to foxi3

Foxi3 169 fkhd forkhead foxi3 CS107 Tegg020K15
FoxJ1 173 fkhd forkhead foxJ1 pCMV-sport6.1 NISC_mq24c11.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 5', MRNA sequence
gi|21080102|gb|BQ392415.1|[21080102]

NISC_mq24c11.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 3', MRNA sequence
gi|21080101|gb|BQ392414.1|[21080101]


FoxJ1 191 fkhd foxj1 pCMV-SPORT6.1 NISC_mq24c11.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 5', MRNA sequence
gi|21080102|gb|BQ392415.1|[21080102]

NISC_mq24c11.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 3', MRNA sequence
gi|21080101|gb|BQ392414.1|[21080101]


FoxJ2 174 fkhd forkhead fox J2 pCMV-sport6.1 NISC_nl03a03.y1 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:5335204 5', MRNA sequence
gi|21378989|gb|BQ520120.1|[21378989]


FoxN4 172 fkhd forkhead foxN4 CS107 Tegg019G15
Foxq1 167 fkhd forkhead foxq1 CS107 Tneu015L12
Frzb 65 Frzb CS107 Genbank Accession #BG886039
not BamH1 - HindIII or R1 OK
RI/T7*
Frzb 72 Frzb fzb CS107 Tgas069i22
Frzb 74 Fzb frzb CS107 Tneu037b10
Fugacin 53 fugacin xnr3 xnr nodal related 3 CS107 see Genbank ID# BG886280
dad51c07.x1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4462861 3' similar to TR:Q91621 Q91621 FUGACIN. ;, MRNA sequence
gi|14263370|gb|BG886280.1|[14263370]
T7 Cla1
Gata-4 258 gata4 gata-4 CS107 TGas120j19
gi|38703057|gb|AL960651.2|AL960651 AL960651 XGC-gastrula
Xenopus tropicalis cDNA clone TGas120j19 5

Gata-4 259 gata4 gata-4 CS107 TGas112g01
gi|39015137|gb|AL963806.2|AL963806 AL963806 XGC-gastrula
Xenopus tropicalis cDNA clone TGas112g01 5', mRNA sequence

gata-5 245 gata5 gata-5 endoderm pCMV-SPORT6.1 dbEST Id: 19434277
EST name: AGENCOURT_15040996
GenBank Acc: CF220508
GenBank gi: 33421216

CLONE INFO
Clone Id: IMAGE:6988214 (5')

Gata-6 67 gata gata6 gata- 6 CS107 Genbank #BG885303
Gata4 108 gata gata4 gata-4 CS107 TNeu111a24 BamHI/T7
Gata6 110 gata gata-6 pCMV-sport6.1 dbEST Id: 12441064
EST name: NISC_ng19g04.y1
GenBank Acc: BQ396239
GenBank gi: 21083926

CLONE INFO
Clone Id: IMAGE:5383878 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11977 Row: N Column: 7
KpnI/T7
gata6 111 gata gata-6 pCMV-SPORT6.1 dbEST Id: 12440736
EST name: NISC_ng17h04.y1
GenBank Acc: BQ395911
GenBank gi: 21083598

CLONE INFO
Clone Id: IMAGE:5383902 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11977 Row: O Column: 7

Gata6 257 gata-6 gata6 pCMV-SPORT6.1 dbEST Id: 12441064
EST name: NISC_ng19g04.y1
GenBank Acc: BQ396239
GenBank gi: 21083926

CLONE INFO
Clone Id: IMAGE:5383878 (5')
claI/T7
Gata6 264 gata-6 gata6 pCMV-SPORT6.1 dbEST Id: 12440736
EST name: NISC_ng17h04.y1
GenBank Acc: BQ395911
GenBank gi: 21083598

CLONE INFO
Clone Id: IMAGE:5383902 (5')

Gbx 2 89 Gbx 2 gbx-2 gbx2 CS107 Tneu059g14
Gbx2 82 Gbx-2 Gbx2 CS107 Tgas027p15
gbx2 121 gbx2b gbx CS107 No 5'
Likely have 3'
TGas037A13

Probe Made*
*ClaI/T7
GDF6 CS107 289 GDF6 CS107 this is just a prepped version of clone Tgas137g21 from Russell's library.
sequence verified
In situ pattern matches published pattern for laevis (Chang and Hemmati-Brivanlou 1999), probe takes a couple days at 4 degrees to come up.
T7/BamHI
geminin 308 geminin pCMV-SPORT6.1 LOCUS CF218367 785 bp mRNA linear EST 04-AUG-2003
DEFINITION AGENCOURT_14976421 NICHD_XGC_Emb5 Xenopus tropicalis cDNA clone
IMAGE:6990029 5', mRNA sequence.
ACCESSION CF218367
VERSION CF218367.1 GI:33419075
/note="Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV;

Goosecoid 38 goosecoid gsc CS107 Tgas02869
Likely have 5' also

Goosecoid 39 goosecoid gsc CS107 Tgas129E16
Likely have 5' also

*Works for in situ (have probe)
BamHi/T7*
Goosecoid 40 goosecoid gsc CS107 Tgas028B9
Most likely have 5' end

Goosecoid 42 goosecoid gsc CS107 Tgas091013
Goosecoid 43 Goosecoid gsc CS107 Tgas075013
Goosecoid 46 Goosecoid gsc CS107 Tneu077F20
Gridlock 213 gridlock hairy enhancer of split pCMV-SPORT6.1 dbEST Id: 19306363
EST name: AGENCOURT_14929401
GenBank Acc: CF149613
GenBank gi: 33245881

CLONE INFO
Clone Id: IMAGE:6980422 (5')


RI/T7
hairy2b.sport 280 hairy2 sport6
t7kpn1
Hb9 218 hb9 xhb9 motor neuron marker pCMV-SPORT6.1 dbEST Id: 12438700
EST name: NISC_ng05h11.y1
GenBank Acc: BQ393875
GenBank gi: 21081562

CLONE INFO
Clone Id: IMAGE:5382764 (5')
Source: IMAGE Consortium, LLN

antisense try RI or kpnI T7
kpnI/T7
Hesr-1 144 hes related 1 hes hesr hesr1 hesr-1 CS107 Tegg121I16 claI/T7
Hnf3a 112 hnf3alpha hnf3a hnf FoxA1 CS107 TGas068H09 RI/T7*
hox1a 126 HOX1A hox CS107 Tneu090p03

it may be hoxb4 but blasted similarity to hox1a
claI/T7
HoxB9 187 hoxb9 pCMV-Sport6.1 AGENCOURT_15100128 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:6996089 5', MRNA sequence
gi|33441773|gb|CF238565.1|[33441773]

EcoRI/T7*
HoxB9 221 hoxb9 pCMV-SPORT6.1 EST name: NISC_ng04d10.y1
GenBank Acc: BQ393597
GenBank gi: 21081284

CLONE INFO
Clone Id: IMAGE:5382211 (5'
LOCUS BC059757 1356 bp mRNA linear VRT 03-FEB-2004
DEFINITION Xenopus tropicalis hypothetical protein MGC75797, mRNA (cDNA clone
MGC:75797 IMAGE:5382211), complete cds.

HoxD10 11 HoxD10 hoxd10 CS107 Tneu001K5
Been tested for in situ - on trop website
T7 Ecor1
HoxD10 20 HoxD10 hoxd10 CS107 Tneu009D23 T7 Ecor1
ID2 97 id-2 id2 id CS107
T7
Id2 102 id id2 CS108

ID3 54 id3 ID3 CS107 Also in Harland database - number 1789
CS107-4.1 kb

*this clone has been tested and works for in situ
RI/T7*
Ikb 315 ikappab, NF-kappaB inhibitor, ikb CS107 LOCUS CR760347 1535 bp mRNA linear VRT 15-SEP-2004
DEFINITION Xenopus tropicalis finished cDNA, clone TNeu099d12.
pCS107; Site_1: EcoRI; Site_2: NotI
EcoRI/T7 or BamHI/T7 should work
Imp2 243 Imp2 Inosine-50 -monophosphate dehydrogenase endoderm pCMV-SPORT6.1 dbEST Id: 19435923
EST name: AGENCOURT_15039937
GenBank Acc: CF222149
GenBank gi: 33422857

CLONE INFO
Clone Id: IMAGE:6986234 (5')

Inturned 71 Inturned CS107 TGas012e01
Genbank Accession # AL629224
claI/T7
irx3 106 irx xiro3 xiro pCMV-SPORT6.1 Image 5383093
IRX3 123 irx3, IRX, xiro3, xiro pCMV-SPORT6.1 Clone Image 5335930
*Works for in situ
R1/T7*
Islet-1 142 islet islet1 islet-1 CS107 Tneu086d13 claI/T7
kit ligand 253 kit steel-2 steel2 stem cell factor scf pExpress-1 dbEST Id: 19886644
EST name: AGENCOURT_15681669
GenBank Acc: CF590621
GenBank gi: 36341257

CLONE INFO
Clone Id: IMAGE:7022366 (5')
claI/T7
Krox-20 155 krox20 krox-20 pCRII-TOPO 3950 nt a portion of Krox20 was amplified from cDNA using the primers GCCCCCATAACTTACCACTTCG and GGATTTTTGTGTGCCTTTTGCG.

pCRII-Topo also has a kanR cassette.
SpeI/T7*
Lbx1 268 lbx1 CS107 Ttpa050H02
Lefty 183 lefty antivin CS107 Tgas031A08
Lefty 189 lefty antivin CS107 Tgas024D09
May have 18s ribosomal RNA somewhere in there? Try Clone #183

Lefty 192 lefty antivin CS107 Tgas052N03
MEIS3 25 MEIS3 Meis3 meis3 CS107 Clone L1G9F05
AL637544

*this clone has been tested and works for in situ
T7/BamH1*
Meis3 26 Meis3 Meis meis3 meis CS107 Tgas014K23 T7 Ecor1
Meis3 27 Meis3 Meis meis3 meis CS107 Tneu006021 T7 BamH1 (not Ecor1)
Mixer 313 mixer CS107 LOCUS AL965856 294 bp mRNA linear EST 05-DEC-2003
DEFINITION AL965856 XGC-gastrula Xenopus tropicalis cDNA clone TGas105b05 5',
mRNA sequence.
pCS107; Site_1: EcoRI; Site_2: NotI
claI/T7
msr 177 xangio1 msr vascular msr1 CS107 Tneu054M15 RI/T7*
Msx1 200 msx1 msx-1 xhox7.1 CS107 Tneu045P11 RI/T7
Msx1 206 msx1 msx-1 xhox7.1 CS107 Tgas131G15
msx2 190 msx-2 xhox7.1' msx pCMV-sport6.1 NISC_mq09g02.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5308202 5', MRNA sequence
gi|21077502|gb|BQ389815.1|[21077502]


NISC_mq09g02.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5308202 3', MRNA sequence
gi|21077501|gb|BQ389814.1|[21077501]

EcorI/T7
Msx2 203 msx2 xhox7.1 CS107 Tgas001O13 EcorI/T7
Myf-5 128 xMyf5 myf 5 myf-5 xmyf-5 CS107 TGas046013 This was supposed to be flk-1. Sequencing and in situ suggest
that it is xMyf-5
BamHI/T7*
myf5 132 myf myf-5 CS107 Tgas042G05 BamHI/T7
Myod 5 Myod myod CS107 Tneu010F7 T7 BamH1 (not Ecor1)
Myod 8 Myod myod CS107 Tneu142K23 T7 BamH1 (not Ecor1)
Myod 9 Myod myod CS107 Tneu016C22 T7 BamH1 (not Ecor1)
Myod 10 Myod myod CS107 Tneu017H11
RI/BamHI cut inside clone

*this clone has been tested and works for in situ
T7/Cla1*
Myod 15 Myod myod CS107 Tneu057J16 T7 BamH1 (not Ecor1)
Myod 17 Myod myod CS107 Tneu065C7 T7 BamH1 (not Ecor1)
NCAM 226 NCAM neural cell adhesion molecule CS107 TTpA054a02 claI/T7
NDGR1 252 ndrg1 pCMV-SPORT6.1 dbEST Id: 19452376
EST name: AGENCOURT_15097956
GenBank Acc: CF238475
GenBank gi: 33441683

CLONE INFO
Clone Id: IMAGE:6993295 (5')

NDRG1 267
pRKW2 dbEST Id: 20094268
EST name: AGENCOURT_15973246
GenBank Acc: CF783804
GenBank gi: 37746575

CLONE INFO
Clone Id: IMAGE:7026048 (5'

Neural Specific Tubulin 52 neural specific tubulin n-tubulin beta-tubulin tubulin n tubulin ntubulin CS107 Tneu143I02

Note this clone is chimeric. The 5' end of this clone is the full length tropicalis neural specific tubulin (~1.7kb). However a portion (about 1.1kb) of 18S sequence is fused to the 3' end of the tubulin clone (same orientation). Therefore this clone is NOT suitable for in situs.
T7 Ecor1
Neural specific tubulin 98 neural specific tubulin n-tubulin beta-tubulin tubulin n tubulin ntubulin pGEM-5Zf(-) 3 kb Clone #52 was partially digested with Nde I (cuts about 21 bp into 18S RNA sequence and then somewhere in CS107 which liberates all of tubulin flanked on the 5'end with some CS107 and then on the 3'end with 21 bp of 18S sequence). [Nde I also cuts in n-tubulin. ] This fragment was purified and then cut with NcoI.
NcoI-NdeI ntubulin cloned into the NcoI-NdeI site of pGEM-5Zf(-)

5' end is at NcoI site- 3'end is NdeI site

*Probe made
apa I/Sp6*
NeuroD 285 neuroD pCMV-Sport6.1 AGENCOURT_14926246 NICHD_XGC_Emb7 Xenopus tropicalis cDNA cloneIMAGE:6979104 5', mRNA sequence. ACCESSION CF149433
/clone="IMAGE:6979104"
/tissue_type="tailbud"
/dev_stage="embryo, stages 20-27"
/lab_host="DH10B (phage-resistant)"
/clone_lib="NICHD_XGC_Emb7"
/note="Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV;
kpnI/T7
Neurogenin 286 neurogenin-1 pCMV-sport6.1 /clone="IMAGE:6977515"
/tissue_type="tailbud"
/dev_stage="embryo, stages 20-27"
/lab_host="DH10B (phage-resistant)"
/clone_lib="NICHD_XGC_Emb7"
/note="Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV;
AGENCOURT_15069957 NICHD_XGC_Emb7 Xenopus tropicalis cDNA clone
IMAGE:6977515 5', mRNA sequence.
ACCESSION CF224521
VERSION CF224521.1 GI:33425229
kpnI/T7
neurogenin-related 284 neurogenin-2 neurogenin related 1 CS107 the insert from IMAGE clone 7093678 was cut with XhoI-NotI and cloned
into the XhoI and NotI sites of pbs KS II.
NotI/T7
Nkx 143 nkx CS107 unclear which nkx. needs to be sequenced
Tneu010A20

Nkx 215
CS107 Tneu105p04
Nkx2.1 228 Nkx2.1 Nkx-2.1 pCRII-topo orientation is SP6 3' Nkx2.1 5' T7 NotI/SP6*
Nkx2.4 229 nkx-2.4 nkx2.4 pCRII-topo orientation is SP6 3' Nkx2.4 3' T7 NotI/Sp6*
Nkx2.5 113 nkx nkx2.5 pCR2.1-topo 3.9 kb
BamHI/T7*
nkx6.1 127 nkx CS107 Tegg079m07 claI/T7
Noelin 208 noelin CS107 Tneu071d23
nog1 140 noggin nog CS108
ClaI/T7
Noggin2 260 noggin-2 noggin2 CS107 EST name: AL792266
GenBank Acc: AL792266
GenBank gi: 38314390

CLONE INFO
Clone Id: TNeu122a14 (5')

Xenopus tropicalis noggin 2 mRNA, complete cds
gi|50982267|gb|AY672092.1|[50982267]


Nrp-1 62 NRP1 nrp-1 CS107 Genbank #BG512402

*this clone has been tested and works for in situ
RI/T7*
ODC 105 odc ornithine decarboxylase CS107

Olig1 299 olig1 olig-1 pCMVsport6 DEFINITION JGI_CAAL9004.fwd NIH_XGC_tropBrn4 Xenopus tropicalis cDNA clone
IMAGE:7666629 5', mRNA sequence.
ACCESSION CX852777
VERSION CX852777.1 GI:58510630
Site_1: SalI; Site_2: NotI

olig2 130 olig2 olig-2 olig CS107 Tneu076F16

This clone pulls up chick olig2 as the first hit with tblastx. The next hit is human olig3.
EcoRI/T7*
olig2 133 olig olig-2 olig2 CS107 Tneu063G03
sequencing was not very good but does pull up olig2 with tblastx.

olig3 124 olig OLIG OLIG3 CS107 no 5'
3' uncertain
TGas060e07

Optx2 232 optx-2 optx2 eye six3 CS107 TTp042O24 T7/ClaI
Osr1 312 osr-1 osr1 odd skipped related 1 pCS107;Site1:EcoRI;Site2:NotI
This insert is inverted!
LOCUS CR761835 1170 bp mRNA linear VRT 15-SEP-2004
DEFINITION Xenopus tropicalis finished cDNA, clone TGas143j06.
ACCESSION CR761835
xhoI/T7
OTX2 29 OTX2 otx2 otx Otx2 CS107 Tgas025F18 T7 Ecor1
OTX2 31 otx2 Otx2 OTX2 otx CS107 LIG12G10
AL643588
*this clone has been tested and works for in situ
T7 Ecor1*
Otx5b 283 Otx5b CS107
t7/claI
Pax1 261 pax-1 pax1 CS107 gi|38395761|gb|BX723020.1|BX723020 BX723020 XGC-tadpole
Xenopus tropicalis cDNA clone TTpA029e07 5', mRNA
FL
gi|38417752|gb|BX745012.1|BX745012 BX745012 XGC-tadpole
Xenopus tropicalis cDNA clone TTpA033a05 5', mRNA sequence

I am not sure which

Pax2 114 pax pax-2 pax2 CS107
BamHI digest/T7 works for in situ. However BamHI digest does produce a second small band 600bp.
T7/ClaI*
PAX3 79 PAX 3 Pax3 Pax-3 CS107 Tneu031e04 BamHI/T7*
pax3 129 psx pax-3 pax3 CS107 Clone TNeu048L09
Pax6 182 pax-6 pax6 pCMV-sport6.1 AGENCOURT_15156619 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:6992220 5', MRNA sequence
gi|33604574|gb|CF264195.1|[33604574]

RI/T7*
Pax8 131 pax pax-8 pax8 pBS KS II approximately 950bp of x.trop pax8 was amplified using the following primers:
ggaattccGGTCACGGAGGTTTGAATCAGTTAG
cgggatcccgTGGGGCTACATAAAGATGAAGGG
which also places an EcoRI site at the 5'end and a BamHI site at the 3'end.
This was amplfiied using Pfu from 25-30 stage x.trop cDNA

Amplicon was cloned into the RI-BamHI site of pBS KS II.
RI/T7*
Pax8 214 pax8 pax-8 CS107 dbEST Id: 19437795
EST name: AGENCOURT_15067591
GenBank Acc: CF223950
GenBank gi: 33424658

CLONE INFO
Clone Id: IMAGE:6977138 (3')

PiI 241 Protein phosphatase inhibitor / IPP-1 PiI endoderm pCMV-SPORT6.1 dbEST Id: 19304699
EST name: AGENCOURT_14929377
GenBank Acc: CF147950
GenBank gi: 33244218

CLONE INFO
Clone Id: IMAGE:6979822 (5')

Protein phosphatase-1 gamma 1 153
CS107 we thought this was sfrp2 but it ain't
Prox1 319 prox-1 prox1 lymphatic PCR2.1 topo Prox1 fragment amplified by PCR. Cloned into topo kit vector PCR2.1 topo and is flanked by EcoRI sites. KpnI/T7
Rfx4v3.sport6 282 Rfx4v3 sport6
t7/
sam68 248 RNA-binding KH domain / Sam68 endoderm pCMV-SPORT6.1 dbEST Id: 19453200
EST name: AGENCOURT_15099032
GenBank Acc: CF239298
GenBank gi: 33442506

CLONE INFO
Clone Id: IMAGE:6995540 (5')

Sek1/ EphA4 34 sek1 sek SEK Sek1 Sek EphA4 eph CS107 Tneu011C01

*this clone has been tested and works for in situ
T7/Ecor1*
sfrp-2 146 secreted frizzled related sfrp sfrp2 sfrp-2 CS107 Tneu137h23 T7/ClaI
sfrp-2 149 secreted frizzled related sfrp2 sfrp-2 sfrp CS107 TNeu109a23
3' end sequencing does not appear to be sfrp-2

SHH 12 shh SHH sonic hedgehog CS107 Tneu023N4

*this clone has been tested and works for in situ
T7/BamH1*
SHH 18 SHH shh sonic hedgehog CS107 Tneu067O14

*this clone has been tested and works for in situ
T7-BamH1*
Siamois 41 siamois Siamois SIAMOIS CS107 Tgas088L16
T7 (not Ecor1, BamH1, or HindIII) - cla1
T7/ClaI*
Six1 224 six-1 six1 sine oculis homeobox CS107 TNeu098p21
Sizzled 147 sizzled CS107 Tneu024k17
Sizzled 148 sizzled CS107 Tgas144c13 ClaI/T7*
Slug 35 SLUG slug Slug CS107 Tneu008A21
Likely have 3' also

*this clone has been tested and works for in situ
T7/BamH1*
Slug 37 SLUG slug Slug CS107 Tneu006i21
LIkely have 3' also

smad1 60 smad1 smad-1 CS107 Genbank ID#BG346829
SMAD10 117 smad10 smad CS107 TGas037H15
3' not present
claI/T7
snail 211 snail CS107 Tgas026k15 claI/T7
Sox 2 75 Sox-2 sox sox2 CS107 Tgas061h22
ClaI/T7*
Sox-2 76 Sox-2 sox sox2 CS107 Tneu054c10
NOTE: This clone gives tons of background when used for in situ probe. (ClaI/T7)
Use #75 instead
Do not use
sox-3 59 sox-3 sox3 sox xsox3 CS107 Genbank ID#BG512766

*this clone has been tested and works for in situ
RI/T7*
Sox-D 57 sox soxD sox D sox-D CS107 Genbank ID# BG348615

*this clone has been tested and works for in situ
RI/T7*
sox1 134 sox 1 sox-1 CS107 TNeu023i18 HindIII/T7
sox1 135 sox 1 sox-1 CS107 TGas002m12 HindIII/T7
Sox1 truncated UTRs 320 Sox1 pBS bluescript I want to test if the UTR regions of the trop Sox1 gene are suppressing activity. This version has most of the UTRs removed. I will use this to transfer the Sox1 gene into pCS108 using Sal1 and Not1 which will then be used for mRNA production.
sox10 209 sox10 sox-10 CS107 Tneu062e04 claI/T7
Sox14 317 XtSox14, Sox 14, Sox-14 CS107 Sox14 was cloned by PCR from tropicalis genomic DNA (single exon gene) and cloned into TOPO vector. It was subcloned into the EcoRI sites of pCS107 and confirmed by restriction digest and by sequencing to be full-length. the sequence completely matches the entire coding sequence of the Sox14 genomic sequence (JGI). BamHI/T7
Sox17-alpha 239 sox17alpha sox17-alpha sox17 alpha pCMV-SPORT6.1 dbEST Id: 19451901
EST name: AGENCOURT_15100518
GenBank Acc: CF238000
GenBank gi: 33441208

CLONE INFO
Clone Id: IMAGE:6994003 (5')
Plate: LLAM14675 Row: f Column:
kpnI/T7*
Sox17-b 238 sox17beta sox17-beta sox17 beta pCMV-SPORT6.1 dbEST Id: 12437211
EST name: NISC_mq24b08.y1
GenBank Acc: BQ392386
GenBank gi: 21080073

CLONE INFO
Clone Id: IMAGE:5309151 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11783 Row: D Column: 16

Sox17beta 58 sox sox-17 sox17 xsox17 beta CS107 Genbank ID#BG886038

**this clone has been tested and works for in situ
RI/T7*
Sox21 316 Sox 21, sox-21, Tneu058o20 CS107 Tneu058o20 EcoRI/T7
Sox9 274 sox-9 sox9 CS107 LOCUS CR855424 2520 bp mRNA linear VRT 03-NOV-2004
DEFINITION Xenopus tropicalis finished cDNA, clone TNeu111f21.
BsrgI/T7
sprouty4 295 sprouty4 sprouty-4 pCMVsport6 DEFINITION JGI_CAAM7345.fwd NIH_XGC_tropTe3 Xenopus tropicalis cDNA clone
IMAGE:7681047 5', mRNA sequence.
ACCESSION CX897186
VERSION CX897186.1 GI:58636530

Site_1: SalI; Site_2: NotI
kpnI/T7
steel 266 kit ligand steel-2 stem cell factor scf pCMV-SPORT6.1 >gi|33604368|gb|CF263989.1|CF263989 AGENCOURT_15157184 NICHD_XGC_Emb6 Xenopus tropicalis cDNA clone
IMAGE:6991375 5'

Tannabin 292 tannabin cartilage pCS108 DEFINITION JGI_XZT32954.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone IMAGE:7608922 5', mRNA sequence.
ACCESSION CX410332
VERSION CX410332.1 GI:57191034
Site_1: SalI; Site_2: NotI; Tadpole
library constructed by Russell B. Fletcher in R. Harland's lab using poly A RNA and oligo dT primers (Invitrogen SuperScript Plasmid System for cDNA Synthesis and Cloning). SalI (5' end) -NotI (3' end) cDNA was inserted into vector pCS108

Tannabin 293 tannabin pCMVsport6 DEFINITION JGI_CAAM7280.fwd NIH_XGC_tropTe3 Xenopus tropicalis cDNA clone
IMAGE:7681030 5', mRNA sequence.
ACCESSION CX897063
VERSION CX897063.1 GI:58636407

Site_1: SalI; Site_2: NotI;

Tie-1 301 tie-1 tie1 vascular pCMVsport6 DEFINITION JGI_CAAN1643.fwd NIH_XGC_tropTe4 Xenopus tropicalis cDNA clone
IMAGE:7687301 5', mRNA sequence.
ACCESSION CX909068
VERSION CX909068.1 GI:58648412

Site_1: SalI; Site_2: NotI

tie-2 300 tie-2 tie2 vascular CS107
DEFINITION JGI_CABE1423.fwd NIH_XGC_tropOva1 Xenopus tropicalis cDNA clone
IMAGE:7820350 5', mRNA sequence.
ACCESSION DN086803
VERSION DN086803.1 GI:59752081


Site_1: EcoRI; Site_2: XhoI

Tie1 297 tie-1 tie1 vascular pCS108 DEFINITION JGI_XZT72863.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7791938 5', mRNA sequence.
ACCESSION CX340557

Site_1: SalI; Site_2: NotI

Initially I thought this clone was Tie2

Tie1 303 tie-1 tie1 pCMVsport6 DEFINITION JGI_CAAN3978.fwd NIH_XGC_tropTe4 Xenopus tropicalis cDNA clone
IMAGE:7689565 5', mRNA sequence.
ACCESSION CX913408
VERSION CX913408.1 GI:58703164

Site_1: SalI; Site_2: NotI

TSG2 233 tsg2 tsg-2 twisted gastrulation 2 pCMV-sport6 gi|36346316|gb|CF593113.1|CF593113 AGENCOURT_15703772
NICHD_XGC_Swb1N Xenopus tropicalis cDNA clone IMAGE:7025399 5'
kpnI/T7
tubulin-alpha 104 alpha tubulin CS107

Twist 44 Twist twist TWIST CS107 Tneu085G21
Twist 45 Twist twist TWIST CS107 Tneu125e01
T7 Ecor1
Twist 47 Twist twist TWIST CS107 Tneu076A5
Twist 48 Twist twist TWIST CS107 Tneu143K24
Twist 49 Twist twist TWIST CS107 Tneu075H18

*this clone has been tested and works for in situ
T7/Ecor1*
Twist 50 Twist twist TWIST CS107 Tneu099J15
Twist 51 Twist twist TWIST CS107 Tneu141P24 T7 Ecor1
twisted gas 88 twisted gastrulation tsg CS107 Tgas066i20
THIS APPEARS TO BE A CHIMERIC CLONE. USE RECORD #91 INSTEAD!

twisted gas 91 twisted gastrulation tsg CS107 Tgas012m12 claI/T7*
VegF 178 vegF CS107 Tegg015L19 ClaI/T7*
Vegfr2 296 vegfr2 vegfr3 vegfr-2 vascular pCMVsport6 DEFINITION JGI_CAAM1546.fwd NIH_XGC_tropTe3 Xenopus tropicalis cDNA clone
IMAGE:7675709 5', mRNA sequence.
ACCESSION CX887487

Site_1: SalI; Site_2: NotI;

This clone has high sequence similarity to both vegfr2 and vegfr3

Vegfr2 298 vegfr2 vegfr-2 vascular pCMVsport6 DEFINITION JGI_CAAJ18374.fwd NIH_XGC_tropBrn2 Xenopus tropicalis cDNA clone
IMAGE:7648284 5', mRNA sequence.
ACCESSION CX807538
VERSION CX807538.1 GI:58362165

Site_1: SalI; Site_2: NotI;


VegT 93 veg vegT CS107 TGas066f22
*Have in situ probe
BamHI/T7*
VegT 94 vegT veg CS107 TGas032N19
Vent-1 56 vent vent-1 vent 1 xvent 1 CS107 Genbank ID# BG487195

*this clone has been tested and works for in situ
RI/T7*
Vent-2 66 xvent Vent 2 vent-2 CS107 BG885317
*Tested and works for in situ
T7/Ecor1*
Vent-2 159 vent-2 vent vent2 CS107 Tgas046D19
vent-2 168 vent vent2 vent-2 CS107 Tgas019L23
VEX-1 86 xVEX-1 vex1 vex xvex CS107 Tneu044o05 claI/T7
Vg1 201 Vg1 CS107 Tegg053L11 T7/ClaI
Vito 262 vito CS107 TGas048e14

AL646219 XGC-gastrula Xenopus tropicalis cDNA clone TGas048e14

Vito 263 vito CS107

VSX1 230 vsx-1 vsx1 pCRII-topo T7 5' vsx-1 3' Sp6 Sp6/NotI
wnt-8 145 wnt wnt8 wnt-8 CS107 TGas015M15 ClaI/T7
wt1 309 wt-1 wt1 wilms tumor-1 pCMV-SPORT6 DEFINITION AGENCOURT_15189827 NICHD_XGC_Sp1 Xenopus laevis cDNA clone
IMAGE:5512168 5', mRNA sequence.
/note="Organ: spleen; Vector: pCMV-SPORT6; Site_1: NotI;
Site_2: SalI
kpnI/T7
XAG 99 XAG XAG-1 XAG-1 cement gland pCMV-SPORT6.ccdb dbEST Id: 12436621
EST name: NISC_mq20g05.y1
GenBank Acc: BQ391796
GenBank gi: 21079483

CLONE INFO
Clone Id: IMAGE:5309001 (5')
Source: IMAGE Consortium, LLNL

Cloned into Not I/RV site
Kpn I/T7
XAG-2 78 XAG-2 xag2 CS107 Tneu029o22
*Probe works (has been tested)
Bamh1/T7*
XAG-2 85 XAG-2 xag2 xag 2 CS107 Tneu033f09
Xanf-1 141 xanf1 xanf-1 CS107 Tneu069M07 claI/T7
XBF-1 227 xBF-1 xbf1 bf-1 bf1 fox forkhead FoxG1 brain factor pCRII-topo orientation is Sp6 5' xbf-1 3' T7 BamHI/T7*
XBra 24 xbra x-bra brachyury CS107 Tneu024F07 (didn't cut with Ecor1/Not1) T7 BamH1
XBra 30 xbra BRA XBRA Xbra bra CS107 Tgas023E12

*this clone has been tested and works for in situ
T7 Ecor1* (not BamH1)
XBra 33 xbra XBRA bra XBra CS107 Tgas020F02
Maybe have 3' of gene
T7 Ecor1
Xcad1 273 xcad1 cad1 cad-1 pRKW2
EST name: AGENCOURT_15774575
GenBank Acc: CF781041
GenBank gi: 37740993

CLONE INFO
Clone Id: IMAGE:7028114 (5')

Xcad1 276 xcad1 cad1 cad-1 pCMV-SPORT6.1
LOCUS BC063344 2777 bp mRNA linear VRT 23-AUG-2004
DEFINITION Xenopus tropicalis cad1, mRNA (cDNA clone MGC:75839 IMAGE:5382575),
complete cds.
ACCESSION BC063344
VERSION BC063344.1 GI:38648966

xcad3 314 xcad3 xcad-3 CS107 LOCUS BX755473 551 bp mRNA linear EST 10-DEC-2003
DEFINITION BX755473 XGC-gastrula Xenopus tropicalis cDNA clone TGas108b24 3',
mRNA sequence.
pCS107; Site_1: EcoRI; Site_2: NotI
claI/T7
Xelk 180 eph receptor pCMV-sport6.1 >gi|21078016|gb|BQ390329.1|BQ390329 NISC_mq12f01.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone
IMAGE:5308177 5'.
XmaI/T7
XFD-1 138 xfd1 foxa4a foxa4 pintallavis xfkh1 CS107 BamHI/T7
XFD-12 160 xfd12 xfd-12 foxd5 fkhd forkhead fox CS107 Tgas055d21 claI/t7
XFD11 156 xFD11 foxc1 fkhd forkhead fox CS107 Tgas132N18
XFD12 158 xfd12 xfd-12 foxd5 fkhd forkhead fox CS107 Tgas063B23
XFD13 272 xfd13 FoxF1b fox CS107 Tneu093i16
XFD13 275 xfd13 FoxF1b fox CS107 Ttpa071G02
xFd4 165 fkhd forkhead fox xfd4 FoxC2 CS107 Tneu106J02
XFD4 170 fkhd forkhead foxC2 XFD4 XFD-4 CS107 Tneu075J16
xHex 63 Hex xhex CS107 Genbank #BG815569
Note this clone is in reverse orientation so that the 5' end is at the Not I site and
the 3' end is at the RI site

This probe never worked for in situ

xHex 107 thex hex CS107 TGas075h17

BamHI/T7*
xhr1 278 xhr1 esr1 hairy enhancer of splir pCMV-SPORT6.1 LOCUS BC075553 1298 bp mRNA linear VRT 20-SEP-2004
DEFINITION Xenopus tropicalis MGC89494 protein, mRNA (cDNA clone MGC:89494
IMAGE:6992227), complete cds.
ACCESSION BC075553
VERSION BC075553.1 GI:49523070
claI/T7
xIro1 223 xIro1 Iro1 iroquois1 iro-1 xiro-1 CS107 TNeu022p19 claI/T7
Xiro3 225 xiro3 iro3 xiro-3 iro-3 iroquois CS107 TTpA012p20
xKRK1 256 krk1 xkrk-1 xkrk1 pCMV-SPORT6.1
EST name: NISC_mq06f10.y1
GenBank Acc: BQ389278
GenBank gi: 21076965

CLONE INFO
Clone Id: IMAGE:5307787 (5')
AgeI/T7
xLim1 234 lim-1 lim1 CS107
clai/t7
XNOT 118 xnot not XNot CS107 3' end not present...maybe not be xnot

tneu017e01
claI/T7
Xnr-1 265 Xnr1 Xnr-1 nodal related CS107 TGas124h10
XNR3 22 xnr3 XNR3 x-nr3 CS107 Tgas011k18 T7 Ecor1
Xnr3/EcorV- 311 Xnr3delta EcorV, Xnr3 MO- CS107 this is our Xnr3 trop construct in CS107 digested with EcorV to remove most of the MO binding site from the 5' UTR (leaves 8bp of 25). then re-ligated and transformed. sequenced 7/11/05 T7 Ecor1
Xolloid 197 xolloid tolloid CS107 Tneu125J24 T7/ClaI
Xpat 240 Xpat pRKW2 dbEST Id: 20092089
EST name: AGENCOURT_15890534
GenBank Acc: CF781625
GenBank gi: 37742192


Xrx1 217
CS107 dbEST Id: 19453395
EST name: AGENCOURT_15097667
GenBank Acc: CF239493
GenBank gi: 33442701

CLONE INFO
Clone Id: IMAGE:6995420 (5')

Zic2 28 Zic2 zic2 zic Zic CS107 Tgas015E14

*this clone has been tested and works for in situ
T7/BamHI*
Zic5 81 Zic 5 Zic5 zic-5 CS107 Tgas042c07

Zic5 92 zic5 zic 5 zic-5 CS107 TGas041c07

This page generated by Mustafa Khokha

Clones identified by the many members of the harland lab